Q5 Site-Directed Mutagenesis Kit E0554S from New England Biolabs

Product Specs
ItemQ5 Site-Directed Mutagenesis Kit
CompanyNew England Biolabs
Price $215.00 Inquire
Catalog NumberE0554S
Quantity10 reactions
ApplicationsDNA Manipulation
TemperatureMulti-Temperature

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) The mRNA architecture of the translation termination site primes programmed stop codon readthrough events in DrosophilaRNA BiolDecember 31, 2026Laveena Kansara, Georg Wolfstetter, Daniel Wintermayr, Ioannis Alexopoulos, Alejandra Escos, Marc Friedländer, Ylva EngströmHk, yemanuclein, CG10321 and CG6282 genes were made with the Q5®-site directed mutagenesis kit (NEB, #E0554S) according to the manufacturer’s instructions. The Renilla luciferase control plasmid (Addgene #38093)

(2) DNA Replication Stress-Induced Transcriptome of Human Burkitt's Lymphoma Identifies Reciprocal Regulation Between MBD1 and BCL6 During Germinal Center-Derived B-LymphomagenesisHematol OncolAugust 6, 2026Santosh Kumar Gothwal, Kyoko Oichai, Hongtae Kim, Kyungjae Myung, Jacqueline H. Barlowbinding motifs on the MBD1 promoter were constructed using the Q5 site‐directed mutagenesis kit (NEB# E0554S) and as per the manufacturer's instructions. Primers used for the site‐directed mutagenesis are listed

(3) Humans homozygous for rare or common hypomorphic IL23R variants are prone to tuberculosisJ Exp MedAugust 3, 2026Diana Olguín Calderón, Laura E. Kilpatrick, Clément Conil, Quentin Philippot, Masato Ogishi, Joseph Vellutini, Ji Eun Han, Narelle Keating, Hailun Li, Geetha Rao, et al.G300V and L372F were generated by site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (#E0554S; NEB) and the following primers: G300V: Forward primer: 5′-TCAAGAAACAGTGAAAAGGTACTGG-3′ Reverse

(4) Fission yeast RPA–TERT–Tpz1 TPP1 complex promotes telomere extension and suppresses telomere recombinationbioRxivJuly 28, 2026Bettina A. Moser, Madeline Points, Sourav Agrawal, Adam C. Didier, Amanda K. Mennie, Ci Ji Lim, Yong-jie Xu, Toru M. Nakamurawith Q5 PCR (NEB, M0491L), Gibson Assembly (NEB, E5510S), or site-directed mutagenesis kits Q5 (NEB, E0554S) or QuikChange Lightning (Agilent, 210519) on plasmids carrying the gene of interest. All constructs

(5) EMT activates ER-to-Golgi trafficking through upregulation of REEP2 to promote lung cancer progressionResearchSquareJuly 22, 2026Guan-Yu Xiao, Oluwafunminiyi Obaleye, Oluwafunminiyi Obaleye, Shike Wang, Jiang Liu, Jonathan M. Kurie, Jonathan M Kurie, William K. Russell, Xiaochao Russell, Xiaochao Xiaothe Dual-Luciferase Reporter Assay System (Promega). Mutagenesis Q5 Site-Directed Mutagenesis Kit (#E0554S, NEB) was used to generate mutants according to the manufacturer’s instructions. The primer sequences

(6) A novel RNA-binding activity of ECD contributes to U5 snRNP stability and pre-mRNA splicingNucleic Acids ResJuly 21, 2026Mohsin Raza, Asher Rajkumar Rajan, Achyuth Kalluchi, Bhopal Mohapatra, Irfana Saleem, Benjamin B Kennedy, Kishor K Bhakat, Hamid Band, M Jordan Rowley, Vimla Bandvector was created using a PCR (polymerase chain reaction)-based site-directed mutagenesis kit (NEB#E0554S), according to the manufacturer’s instructions. The primer sequences used for mutagenesis are listed

(7) Neuron-derived neurotrophic factor-positive interneurons: a cellular target for anti-seizure therapiesEBioMedicineJuly 21, 2026Amy Richardson, Marion S. Mercier, Yoshiteru Shimoda, Robert T. Graham, Marco Leite, Alejandro Garcia, Maud Muller, Suraya A. Bond, Maria Grozdanova, Qimin Wu, et al.hM3Dq transgene from the pAAV-mDlx-DIO-hM3Dq-mCherry plasmid using Q5 site-directed mutagenesis (NEB E0554S) with the primers Fwd—GGTGGCGCTAGCATAACTT and Rev—GCCACCATGGTGAGCAAG. Following PCR amplification and

(8) Uniparental Disomy Reveals Hidden Genetic Causes of Congenital Heart DiseaseResearchSquareJuly 20, 2026Sheng Chih Kong, Nahyun Abello, Christopher Jongsoo Abello, Christopher Ruttenberg, Andrew Ruttenberg, Jahmiera Richee, Jahmiera Richee, Kevin M. Bowling, Matheus Vernet Machado Bressan Bowling, Matheus Wilke, et al.the plasmid using a combination of the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat. #: E0554S) and the NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, Cat. #: E5520S). Whole Plasmid

(9) Activation of EZH2 Promoter Is Mediated by MAPK Signaling Regulated Transcription Factors in Anaplastic Thyroid CancerInt J Mol SciJuly 18, 2026Marcella Maringolo Cristovão, Diego Claro de Mello, Edna Teruko Kimura, Cesar Seigi Fuziwarawere performed using Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA, cat. E0554S) and primers (Table S4) designed in NEBase Changer website (https://nebasechanger.neb.com/) (accessed

(10) Purine and pyrimidine-based bacterial cyclic dinucleotides egress the phagosome and activate the cytoplasmic innate immune sensor STINGImmunityJuly 17, 2026Stephanie A. Ragland, Katherine E. Lindblad, Yao Li, Joon H. Choi, Daniel Okin, Joshua Q. Mao, Desmond Richmond-Buccola, Daniela R. Coronado, Madison R. Brown, Scott B. Snapper, et al.clones selected for with 100 μg/mL ampicillin. To mutate CDN synthase codons, Q5 mutagenesis (NEB # E0554S) on pDNA was performed according to the manufacturer’s instructions using primers designed via NEBaseChanger

(11) The p.R249W Mutation in LMNA-Related Congenital Muscular Dystrophy Causes Nuclear Deformities and an Enrichment in Lamin A/C at the Ends of the NucleusCellsJuly 16, 2026Catherine Harvey, Zixuan Zhu, Iden Han, Kan Caointroducing a c.745C>T mutation into the GFP–Prelamin A lentiviral vector by site-directed mutagenesis (#E0554S; NEB, Ipswich, MA, USA). Successful mutagenesis was validated through Sanger sequencing. A GFP–Lamin

(12) Design and in silico validation of donor DNA for RNA-guided recombinase-mediated knockout of mstnb gene in Labeo rohitaPLoS OneJuly 15, 2026Lukram Sushil Singh, Porkodi Murugesan, Gowhar Iqbal, Nagavara C. Nidarshan, Harini Gunasekaran, Ad. Viralkumar, Kiran D. Rasal, Manoj P. Brahmane, Sunil K. Nayak, Arvind A. Sonwane, et al.containing insert went site-specific mutagenesis through Q5 Site-Directed Mutagenesis Kit (NEB, Cat. No.: E0554S), using Q5 Hot Start High-Fidelity DNA Polymerase and a primer pair with a custom mutagenic primers

(13) A pooled image-based CRISPR screen identifies EAF1 as a T. gondii modulator of ESCRT subversionbioRxivJuly 9, 2026Einar B. Olafsson, Christophe-Sebastien Arnold, Jacob A. Kellermeier, Patrick A. Rimple, Hargobinder Kaur, Yifan Wang, Jonathan Z. Sexton, Staffan Svärd, Vern B. Carruthers, Matthew J. O'Mearamonoclonal RHCas9DsRed. RHCas9DsRedΔgra14 and RHCas9DsRedΔsag1 were generated by Q5 mutagenesis (NEB E0554S) of pU6-DHFR-GRA14-gRNA1 (primers 5,6) and pU6-DHFR-SAG1-gRNA4 (primers 5,9), Sanger-verified, linearized

(14) Biallelic RSPH4A loss-of-function variants cause primary ciliary dyskinesia in a Chinese patientFront GenetJuly 8, 2026Yu-Ting Lu, Hui-Yan Tang, Kai Chen, Ding-Yuan Lai, De-Cheng Wang, Fan Yangfrom the wild-type template using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat. No. E0554S) according to the manufacturer’s protocol. For c.2T>C (p.Met1Thr), the following mutagenic primers were

(15) Human germline biallelic loss-of-function OSMR variants cause severe allergic diseaseJ Hum ImmunJuly 6, 2026Simran Samra, Mehul Sharma, Julia Körholz, Yihui Liu, Alyssa James, Christina Michalski, Pariya Yousefi, Kate L. Del Bel, Henry Y. Lu, Ashish A. Sharma, et al.FPLCA variants (c.2072T>C, c.1891G>T, c.1538G>A, c.1385A>G), a Q5 site-directed mutagenesis kit (Cat#: E0554S; New England Biolabs) was used according to the manufacturer’s recommendations, with primer pairs noted

(16) Next-generation chemogenetic inhibition using a brain-permeant non-prescription agentSignal Transduct Target TherJuly 3, 2026Steven O. Devenish, Sahil D. Patel, Laura V. Ussingkær, Luiz F. Almeida Silva, Olivia Goff, Amy Richardson, Jesse I. Mobbs, Hariprasad Venugopal, David M. Thal, Dimitri M. Kullmann(Agilent, Fisher Scientific cat. no. NC9045762) or the Q5 Site-Directed mutagenesis kit (NEB, cat. no. E0554S), and verified by Sanger sequencing. Plasmids for transfection were purified with the NucleoBondTM Xtra

(17) Distinct associations of pioneer factor Ascl1-E12a with nucleosomes drive changes in cell fateMolecular CellJuly 2, 2026Bing-Rui Zhou, Edgar Luzete-Monteiro, Jingchao Zhang, Naomi Takenaka, Hsin-Yao Tang, Meilin Fernandez Fernandez Garcia, Mariel Coradin, Megan Frederick, Greg Donahue, Benjamin Garcia, et al.I0516–5ML ,, Critical commercial assays,, Q5® Site-Directed Mutagenesis Kit,New England Biolabs,Cat# E0554S Phusion® High-Fidelity DNA Polymerase,New England Biolabs,Cat# M0530L LiTaq PCR Master Mix,LifeSCT,Cat#

(18) Tissue-dependent enzymatic control of N-acetyl-β-alanine by PTERJournal of Biological ChemistryJuly 1, 2026Ruida Li, Sipei Fu, Zhenyu Lyu, Boyuan Wang, Rowan Hassman, John Shuster, Thomas Kizzar, Judith A. Simcox, Wei Weimutagenesis Point mutations were introduced into mPTER using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) to alter amino acid residues predicted to contribute to zinc coordination, substrate (N-acetyl-β-alanine)

(19) Trio analysis in dystonia identifies de novo KLC1 variants in a kinesinopathy with distinct motor and neurodevelopmental featureseBioMedicineJuly 1, 2026Elisa Peirano, Laura O’Regan, Philip Harrer, Ivana Dzinovic, Magda S. Chegkazi, Petra Havrankova, Theresa Brunet, Rossella Capolino, Claudia Cesario, Stefania Ferro, et al.performed using the Q5 site-directed mutagenesis kit (New England Biolabs, USA; RRID:SCR_013517, cat. No. E0554S) with the following set of primers: D253A_f: CGACCATCCAGCCGTTGCGACC, D253A_r: TGACCAGAGGTCTTCTCCAGG,

(20) Phospholipase Cβ regulates negative associative memory through calcium dependent and independent mechanismsJournal of Biological ChemistryJune 29, 2026Pingjin Chu, Madison Rennie, Suzanne Scarlataperformed to substitute histidines 331 and 378 with alanine using Q5 Site-Directed Mutagenesis Kit (E0554S, NEB) and Q5 High-Fidelity DNA Polymerase (M0491S, NEB). Cell culture Rat pheochromocytoma cells (PC12;

Write a Review

(1)

1/24/2024Mutagenesis Kit From New England Biolabs Enables Rapid, Site-Specific Mutagenesis of Double-Stranded Plasmid DNA Aditi KothariThe Q5 Site-Directed Mutagenesis Kit enables rapid, site-specific mutagenesis of double-stranded plasmid DNA in less than 2 hours. The kit utilizes the robust Q5 Hot Start High-Fidelity DNA Polymerase... Read Review
(1)

4/14/2023Great Kit for Site-Specific Mutation YONG MThe Q5® Site-Directed Mutagenesis Kit was purchased to create the point mutation in plasmid. The protocol is very clear and the steps is pretty simple and fast. Site mutation is successfully created.

Q5 Site-Directed Mutagenesis Kit

Q5 Site-Directed Mutagenesis Kit from New England Biolabs

New England Biolabs

Citations (1214)

Reviews

Q5 Site-Directed Mutagenesis Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map