Q5 Site-Directed Mutagenesis Kit E0554S from New England Biolabs

Product Specs
ItemQ5 Site-Directed Mutagenesis Kit
CompanyNew England Biolabs
Price $215.00 Inquire
Catalog NumberE0554S
Quantity10 reactions
ApplicationsDNA Manipulation
TemperatureMulti-Temperature

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) The mRNA architecture of the translation termination site primes programmed stop codon readthrough events in DrosophilaRNA BiolDecember 31, 2026Laveena Kansara, Georg Wolfstetter, Daniel Wintermayr, Ioannis Alexopoulos, Alejandra Escos, Marc Friedländer, Ylva EngströmHk, yemanuclein, CG10321 and CG6282 genes were made with the Q5®-site directed mutagenesis kit (NEB, #E0554S) according to the manufacturer’s instructions. The Renilla luciferase control plasmid (Addgene #38093)

(2) Human germline biallelic loss-of-function OSMR variants cause severe allergic diseaseJ Hum ImmunJuly 6, 2026Simran Samra, Mehul Sharma, Julia Körholz, Yihui Liu, Alyssa James, Christina Michalski, Pariya Yousefi, Kate L. Del Bel, Henry Y. Lu, Ashish A. Sharma, et al.FPLCA variants (c.2072T>C, c.1891G>T, c.1538G>A, c.1385A>G), a Q5 site-directed mutagenesis kit (Cat#: E0554S; New England Biolabs) was used according to the manufacturer’s recommendations, with primer pairs noted

(3) Novel bispecific T-cell engagers overcoming acquired EGFR resistanceMAbsMay 19, 2026Lennart Kühl, Ann-Kathrin Löffler, Oliver Seifert, Dennis Michler, Miriam Kuhlmann, Giulio Russo, Philipp Kuhn, Helena Nowack, André Frenzel, Thomas Schirrmann, et al.Mutations in the ECD of human EGFR were introduced by site-directed mutagenesis (New England Biolabs #E0554S). Recombinant protein was isolated from supernatants using protein A resin (Fc-comprising molecules;

(4) Epistasis and background dependence in the evolution of Omicron variants of the SARS-CoV-2 spike proteinMol Biol EvolMay 16, 2026Alief Moulana, Thomas Dupic, Michael M Desaiselection and a yeast mating factor for protein localization. Using site-directed mutagenesis (NEB #E0554S), we generated additional plasmids expressing RBD variants Wuhan Hu-1 + Q498R (pAB102), Wuhan Hu-1 +

(5) Drug-induced changes in connectivity to midbrain dopamine cells revealed by rabies monosynaptic tracingElifeMay 15, 2026Katrina Bartas, Pieter Derdeyn, Guilian Tian, Jose J Vasquez, Ghalia Azouz, Cindy M Yamamoto, May Hui, Kevin T BeierRRID:Addgene_232922", Commercial assay or kit,Q5 Site-directed mutagenesis kit,New England Biolabs,E0554S, Commercial assay or kit,Luna Universal One-Step RT-qPCR Kit,New England Biolabs,E3005L, "Chemical

(6) The DND1–NANOS3 complex shapes the primordial germ cell transcriptome via a heptanucleotide sequence in mRNA 3′ UTRsbioRxivApril 30, 2026Masataka Suzawa, Chen Qiu, Ahsan H. Polash, Misaki Yamaji, Alexis A. Jacob, Wataru Horikawa, Eva M. Farroha, Murchana Barua, Xuesong Feng, Chengyu Liu, et al.were introduced into pFRT/TO-NANOS3-VH-P2A-FH-DND1 using the Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) according to the manufacturer’s instructions, with primers listed in Supplementary Table 4. All constructs

(7) ReDisulphID: A discovery platform for thiol redox sensors identifies a druggable site regulating p53 activationRedox BiolApril 29, 2026Pierre Coleman, Anna Laddach, Rhys Anderson, Xiaoping Yang, Ravi Kumar, Ajay Shah, Franca Fraternali, Joseph R. Burgoynerespectively). PEPD C58A and C158A mutants were generated using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with the following primer-pairs: C58A: TCAGCGCTACGCCACCGACACCGG/GTCTCCTCCCCGCCCTGA, C158A: CGGCAGTGTCGCCAGGGAGGCCTC/CTGTCCGTGTTGACGCCA. 2.6

(8) PARP4 ADP-ribosylates PIDD1 to complete a phospho/SUMO/PAR-ylation cascade that orchestrates PIDDosome assemblySci AdvApril 29, 2026Richa B. Shah, Yuanyuan Li, Ashley Person, Léonie Frigon, Nina Ðukić, Ela Kini, Raymond Chen, John M. Pascal, Michael S. Cohen, Ivan Ahel, et al.VSV-RAIDD-FL according to the manufacturer’s instructions using a Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). GFP-tagged PARP4, yellow fluorescent protein (YFP)–tagged PARP14 WT, G832E, and R1699A cDNAs were

(9) Mechanistic design of cell-penetrating disruptors for phospho-dependent TACC3-CHC interactionStructureApril 27, 2026Vanda Gunning, Matthew Batchelor, Krista K. Alexander, Martin Walko, Taylor C. Dill, Selena G. Burgess, Stephen J. Royle, Eileen J. Kennedy, Richard Baylissmutations K506A and K507A were introduced by site-directed mutagenesis using Q5 mutagenesis kit (NEB, E0554S). GB1-TACC3 is the small protein GB1 104 fused to a short, disordered peptide sequence from human TACC3

(10) Development of a novel simplified Q-system with integrated temporal expression controlbioRxivApril 25, 2026Ji-Eun Ahn, Hubert Amreinmodules: Temperature-sensitive inteins were obtained by site-specific mutagenesis (Q5 site-directed mutagenesis kit, NEB Cat# E0554S) and standard PCR (98°C for 10 sec, 56 ~ 64°C for 30 sec, 72°C for 3 min for 25 cycles) using plasmid

(11) Piezo1-mediated mechanohydraulic control of cell volume drives cardiac morphogenesisSci AdvApril 24, 2026Christina Vagena-Pantoula, Konstantinos Kalyviotis, Shuyi Feng, Antoine Sanchez, Igor Kondrychyn, Moe Fukumoto, Xiangbin Pan, Thomas Juan, Didier Y. R. Stainier, Periklis Pantazis, et al.KK5101). Mutagenesis Site-directed mutagenesis was performed using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, NEB, E0554S) according to the manufacturer’s guidelines. Primers for site-directed mutagenesis were designed using

(12) SPNS2 exports sphingosine-1-phosphate and imports glucoseNat CommunApril 20, 2026Cynthia Weigel, Md Lokman Hossen, Ryan D. R. Brown, Can E. Senkal, Christopher D. Green, Jason Newton, Sumit Saha, Elisa N. D. Palladino, Bin Ni, Francesco S. Celi, et al.e.g. substitution of single nucleotides, was performed with the Q5 Site-Directed Mutagenesis Kit (#E0554S, New England Biolabs) and double-stranded SPNS2 (NM_001124758) Human Tagged ORF Clone in pCMV6-AC-GFP.

(13) Polarized SOS activity orchestrates FGF-directed cell migration in vivoCurrent BiologyApril 20, 2026Theresa V. Gibney, Laila Y. Latifi, Jacob I. Mardick, Neal R. Rasmussen, Maria C. Lyons, Meera V. Sundaram, David J. Reiner, Ariel M. PaniQ5 High-Fidelity 2X Master Mix,New England Biolabs,M0492L Q5 Site-Directed Mutagenesis Kit,New England Biolabs,E0554S Key Resources Table

(14) Chromatin association promotes UBR5-mediated degradation of RbbioRxivApril 17, 2026Shuyuan Zhang, Michael C Lanz, Joshua Konschnik, Jan M Skotheimvariants in cells, we used a doxycycline-inducible Rb cassette35, and performed site-directed mutagenesis (E0554S, NEB) to generate Rb variant plasmids. All the plasmids were PiggyBac transposon vectors containing

(15) hnRNPUL1 has a dead polynucleotide kinase domain that regulates RNA and protein interactionsiScienceApril 17, 2026Carmen V. Apostol, Ang Li, Peter Daniels, Llywelyn Griffith, Johnathan Cooper-Knock, Elisa Aguilar-Martinez, Ivaylo D. Yonchev, Ashleigh G.R. Whelan, Pamela J. Shaw, Ian M. Sudbery, et al.Gibson assembly cloning kit,New England Biolabs,Cat# E5510S Q5 Site-Directed Mutagenesis Kit,New England Biolabs,Cat# E0554S ,, Deposited data,Deposited data,Deposited data ,, Uncropped gel images,This paper,https://doi.org/10.17632/rh3prrcskn.1 ,, Experimental models

(16) Modulation of Oncogenic KRAS Signaling by Branched Actin-driven Cell Membrane ProtrusionsbioRxivApril 16, 2026Gabriel Muhire Gihana, Kushal Bhatt, Bo-Jui Chang, Vasanth Murali, Felix Zhou, Jungsik Noh, Roshan Ravishankar, Hazel Borges, Jinlong Lin, Jessica Oceguera, et al.competent cells using the KLD reaction of the Q5 site directed mutagenesis kit (New England Biolabs, E0554S). The plasmid was sequenced for verification. The genes cloned into the pLVX vector were inserted after

(17) AMPK/mTORC2/AKT-473/RUNX2 signaling axis modulates epithelial-mesenchymal transition and bone tropism in breast cancerFront OncolApril 10, 2026Meher Bolisetti Gayatri, Abhayananda Behera, Suresh Chava, Preeti Vyakaranam, Ganesh Venkatraman, Suresh Kumar Rayala, Aramati Bindu Madhava Reddyvector followed by S118A and S118D site-directed mutation using the NEB site-directed mutagenesis kit (#E0554S). Nuclear and cytosolic extraction Cells were treated with the indicated drugs for 6 hours then collected

(18) c-MYC is an aggregation-prone, amyloidogenic proteinbioRxivApril 9, 2026Ling Lin, Kun-Han Chuang, Chengkai Dai2xHA-MYCΔC+ΔP12, and 2xHA-MYCΔC+ΔP2+ΔP12 were generated using the Q5 Site-Directed Mutagenesis kit (cat#E0554S, New England Biolabs Inc.). pMYC-SEAP was purchased from Clontech Laboratories (Cell signaling pathway

(19) PHIP suppresses NuRD to enable the growth of SWI/SNF-mutant cancersNat CommunApril 7, 2026Hayden A. Malone, Jacquelyn A. Myers, Emma G. Gruss, Marc A. Morgan, Jake D. Friske, Tabitha C. McCarty, John J. Navarro, Sarah Robinson, Rebecca L. Halliburton, Sandra J. Kietlinska, et al.deleted from the Xlone-PHIP construct by using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0554S). Cells received the Super PiggyBac Transposase expression vector (System Biosciences, PB210PA-1) and

(20) Heparan sulfate is essential for Drosophila FGF exportbioRxivApril 6, 2026Guilherme Oliveira Barbosa, Christian Solis-Calero, Thomas B. KornbergThe mutations were made on pAc5.1-Bnl:GFP11(7x) with the Q5® Site-Directed Mutagenesis Kit (NEB Cat#: E0554S). A set of four plasmids were created to track the biosynthetic pathway of Bnl by GFP reconstitution.

Write a Review

(1)

1/24/2024Mutagenesis Kit From New England Biolabs Enables Rapid, Site-Specific Mutagenesis of Double-Stranded Plasmid DNA Aditi KothariThe Q5 Site-Directed Mutagenesis Kit enables rapid, site-specific mutagenesis of double-stranded plasmid DNA in less than 2 hours. The kit utilizes the robust Q5 Hot Start High-Fidelity DNA Polymerase... Read Review
(1)

4/14/2023Great Kit for Site-Specific Mutation YONG MThe Q5® Site-Directed Mutagenesis Kit was purchased to create the point mutation in plasmid. The protocol is very clear and the steps is pretty simple and fast. Site mutation is successfully created.

Q5 Site-Directed Mutagenesis Kit

Q5 Site-Directed Mutagenesis Kit from New England Biolabs

New England Biolabs

Citations (1144)

Reviews

Q5 Site-Directed Mutagenesis Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map