Q5 Site-Directed Mutagenesis Kit E0554S from New England Biolabs

Product Specs
ItemQ5 Site-Directed Mutagenesis Kit
CompanyNew England Biolabs
Price $215.00 Inquire
Catalog NumberE0554S
Quantity10 reactions
ApplicationsDNA Manipulation
TemperatureMulti-Temperature

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) The mRNA architecture of the translation termination site primes programmed stop codon readthrough events in DrosophilaRNA BiolDecember 31, 2026Laveena Kansara, Georg Wolfstetter, Daniel Wintermayr, Ioannis Alexopoulos, Alejandra Escos, Marc Friedländer, Ylva EngströmHk, yemanuclein, CG10321 and CG6282 genes were made with the Q5®-site directed mutagenesis kit (NEB, #E0554S) according to the manufacturer’s instructions. The Renilla luciferase control plasmid (Addgene #38093)

(2) Novel bispecific T-cell engagers overcoming acquired EGFR resistancemAbsDecember 1, 2026Kühl L, Löffler AK, Seifert O, Michler D, Kuhlmann M, Russo G, Kuhn P, Nowack H, Frenzel A, Schirrmann T, et al.Mutations in the ECD of human EGFR were introduced by site-directed mutagenesis (New England Biolabs #E0554S). Recombinant protein was isolated from supernatants using protein A resin (Fc-comprising molecules;

(3) PLOD1 Catalytic Activity Stabilizes ENO1 by Limiting FBXW7-dependent Degradation to Promote Glycolysis and TMZ Resistance in GlioblastomaAdv Sci (Weinh)September 27, 2026Fen Xue, Dingkong Liang, Xin Chen, Fei Fan, Xiayun HeMutagenesis Site‐directed mutagenesis was performed using the Q5 Site‐Directed Mutagenesis Kit (NEB, E0554S) to generate the following constructs, all based on the pLVX‐Flag‐PLOD1 or pLVX‐HA‐ENO1 backbones: PLOD1‐CD:A

(4) Truncating RELA variants drive autoinflammation and autoimmunity by impairing the negative feedback control of NF-κBJCI InsightSeptember 22, 2026Nadja Lucas, Sophia Weidler, Antonia A. Eicher, Baerbel Keller, Özlem Satirer, Adam Desrochers, Timothy J.S. Ramnarine, Mohammad Mokhtari, Sophie Elstner, Timmy Strauss, et al.using QuikChange Lightning (Agilent Technologies, 210518) or Q5 Site-Directed Mutagenesis kit (NEB, E0554S) and the following primers (Eurofins Genomics): R198*: fwd: CGAGCTCAAGATCTGCTGAGTGAACCGAAACTC and rev:

(5) The risk of nephrotic range proteinuria and kidney failure in primary laminopathies is genotype-specificJCI InsightSeptember 22, 2026Sebastian Sewerin, Charlotte Aurnhammer, Mohamed Hamed, Gwladys Revêchon, Ria Schönauer, Christin Findeisen, Konstanze Miehle, Šárka Tesařo Vá, Theodoros Georgomanolis, Carsten Bergmann, et al.gene, NM_170707.4) were introduced into these constructs using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs, Ipswich, MA, USA). Correct mutagenesis was verified by Sanger sequencing. For

(6) Local translation couples synaptic activity to mitochondrial adaptation in dendritesbioRxivSeptember 20, 2026Madison T. Jones, Natalie Noble, Robert B. Darnell, Ezgi HacisuleymaneIF4G2 phosphorylation-site mutation was introduced using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). The somatic localization signal was adapted from Mendonsa et al.23 and consisted of the Lynx1 3′UTR

(7) N-Terminal Basic Helix and S120 Phosphorylation Cooperatively Regulate Nuclear Localization of UBE2A/B in MechanotransductionBiology (Basel)September 16, 2026Mingwei Feng, Fumihiko Nakamuraplasmid using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Inc., Ipswich, MA, USA; Cat. No. E0554S) Ube2a WT and S120D fragments were amplified from HA-tagged plasmids, digested with BamHI and NotI,

(8) Profilin promotes lamellipodium protrusion by tuning the antagonistic activities of capping protein and VASPNat CommunSeptember 16, 2026Yubo Tang, Matthias Schaks, Xinqi Jiang, Marius Karger, Magdalena Mietkowska, Julian Kaltenhäuser, Jonas Scholz, Ruth Benavente-Naranjo, Sijian Hu, Sarah Körber, et al.(Y6D) or actin binding (R88E) were subsequently generated using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and forward primers 5′-GTGGAACGCCGATATCGACAGCC-3′ (with reverse 5′-CCGGCCATGGAAGCTTGA-3′ for amplification)

(9) Small molecule inhibition of the mitochondrial lipid transfer protein STARD7 attenuates influenza viral replicationPLoS PathogSeptember 11, 2026Shipra Sharma, Oyahida Khatun, Jihaan Adonis, Shaochen You, Kevin Hartenbower, Vedita Anand Singh, Namir Shaabani, Saikat De, Emi R. Matsuo, Rachel Y. Sattler, et al.obtained from Origene (RC202539). Cysteine mutants were generated using site-directed mutagenesis (NEB E0554S). For immunoprecipitation studies using FLAG-tagged transgenes, HEK293T cells (5 × 106) were transfected

(10) Domain-Swapped LuxR-Type Quorum Sensing Receptors Reveal Divergent Ligand-Response Mechanisms among HomologuesJ Am Chem SocSeptember 9, 2026Irene M. Stoutland, Susan A. Walker, Helen E. BlackwellQ5 Site-Directed Mutagenesis Kit according to the manufacturer’s protocol (New England Biolabs cat. no. E0554S) or Gibson assembly (New England Biolabs cat. no. E2611). All chimera reporters were created by transforming

(11) UV irradiation drives lineage-specific MITF-mediated transcription of PD-L1 to confer immune tolerance to UV-mutated melanocytesImmunitySeptember 8, 2026Jennifer A. Lo, Inbal Rachmin, Jessica L. Flesher, Xunwei Wu, Akinori Kawakami, Miroslav Hejna, Judith R. Boozer, Nhu Nguyen, Andrew D. King, Yawen Ji, et al.Cloning Kit,Takara / Clontech,Cat# 639648 Q5 Site-Directed Mutagenesis Kit,New England Biolabs,Cat# E0554S Gibson Assembly Master Mix,New England Biolabs,Cat# E2611 Dual-Luciferase Reporter Assay System,Promega,Cat#

(12) Fission yeast RPA-TERT-Tpz1TPP1 complex promotes telomere extension and suppresses telomere recombinationPLoS GenetSeptember 8, 2026Bettina A. Moser, Madeline Points, Sourav Agrawal, Adam C. Didier, Amanda K. Mennie, Ci Ji Lim, Yong-Jie Xu, Toru M. Nakamurawith Q5 PCR (NEB, M0491L), Gibson Assembly (NEB, E5510S), or site-directed mutagenesis kits Q5 (NEB, E0554S) or QuikChange Lightning (Agilent, 210519) on plasmids carrying the gene of interest. All constructs

(13) High levels of the cardiomyocyte-specific kinase Tnni3k impair zebrafish heart regeneration by driving chronic myocardial inflammationbioRxivSeptember 8, 2026Miriam Fernández-Lajarín, Sean Keeley, Juan Manuel González-RosaThe point mutation in the ATP-binding site was generated using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs). Tol2 flanking sites were used to maximize transgenesis. The resulting plasmid

(14) Loss-of-function mutations in Ccdc113 cause male infertility in both humans and miceAsian Journal of AndrologySeptember 1, 2026Hong-Tao Yu, Fu-Lin Liu, Xiao-Xiao Zhang, Wei Li(c.901A>C; p.K301Q and c.404A>C; p.E135A) were generated using the Q5® Site-Directed Mutagenesis Kit (E0554S; New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions. All constructs

(15) Multisite Threonine Phosphorylation in the SPT5 C-Terminal Region 1 Enables Sequence-Dependent Regulation without Global Structural RemodelingThe Journal of Physical Chemistry BAugust 20, 2026Rong Hu, Emery T. Usher, Olivia A. Fraser, Wei Chen, Alex S. Holehouse, Scott A. Showalterligation independent cloning. All mutagenesis was accomplished with Q5 site directed mutagenesis (NEB E0554S), with primers designed via NEBaseChanger and procured from Integrated DNA Technologies. Mutants generated

(16) The calcium-binding protein CSE links Ca2+ signaling with cell-cell communication in cyanobacteriaThe EMBO JournalAugust 13, 2026Teresa A Müller, Felicia Stahlecker, Karolina Roganowicz, Sherihan Samir, Gregor L Weiss, Murray Coles, Khaled A SelimMicroscopy Sciences,FCF200-CU-SB Uranyl acetate,N.A.,N.A. NEB Q5 site-directed mutagenesis kit,NEB,E0554S Anhydrotetracycline,Thermo Scientific,Cat. 233131000 Strep-Tactin®,IBA Lifesciences GmbH,N/A Chelex

(17) Characterization of the intrinsic AmpC β-lactamase of Escherichia marmotae and its impact on decreased susceptibility to cefiderocol and resistance to broad-spectrum cephalosporinsJ Antimicrob ChemotherAugust 13, 2026Samanta Freire, Sandra Martinez Alvarez, Jacqueline Findlay, Miriam Vogel, Patrice Nordmann, Laurent Poirelextended spectrum of the EMC-2, site-directed mutagenesis using the Q5 Site-Directed Mutagenesis kit (ref. E0554S; New England Biolabs, Ipswich, MA, USA) was performed using EMC-1 as template, to generate deletion

(18) PUF family RNA-binding proteins Puf1 and Puf2 promote transcript degradation in Toxoplasma gondiiJournal of Biological ChemistryAugust 12, 2026Chitti Raju Khandavalli, Rajkumar Gurupwar, Abhijit S. DeshmukhpSAG1::Cas9-U6::sgUPRT plasmid (#54467, Addgene) using a Q5 Hot Start site-directed mutagenesis kit (#E0554S, NEB) and with specific primers (Table S1). The process aimed to induce double-strand DNA breaks and

(19) Functional dissection of HCMV gB’s autonomous fusion activity provides insights into how polymorphisms in clinical isolates confer distinct characteristicsmBioAugust 12, 2026Xiaohan Chen, Barbara Kropff, Jiawen Li, Heinrich Sticht, Madlen Mollik, Marie Sieger, Fulvia Ferrazzi, Irene Görzer, Michael Mach, Marco ThomasNew England Biolabs GmbH, Frankfurt am Main, Germany) or Q5 Site-Directed Mutagenesis Kit (Catalog #E0554S, New England Biolabs GmbH, Frankfurt am Main, Germany) with the pairs of primers listed in Table 1.

(20) Human PMS1-dependent non-canonical mismatch repair engages with MBD4 to repair methylated CpG deaminationNucleic Acids ResAugust 11, 2026Anaïs Le Ven, Sandra Vanhuele, Olivier Ganier, Alexandre Houy, Amanda Kahn, Manuel Rodrigues, Marc-Henri Stern, Raphael Guerois, André Bortolini SilveiraCMV-YE1-BE3-FNLS-CMV-mCherry [30] (Addgene, #154005) was reengineered with the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). First, we removed its uracil glycosylase inhibitor, which was originally intended to inhibit BER and

Write a Review

(1)

1/24/2024Mutagenesis Kit From New England Biolabs Enables Rapid, Site-Specific Mutagenesis of Double-Stranded Plasmid DNA Aditi KothariThe Q5 Site-Directed Mutagenesis Kit enables rapid, site-specific mutagenesis of double-stranded plasmid DNA in less than 2 hours. The kit utilizes the robust Q5 Hot Start High-Fidelity DNA Polymerase... Read Review
(1)

4/14/2023Great Kit for Site-Specific Mutation YONG MThe Q5® Site-Directed Mutagenesis Kit was purchased to create the point mutation in plasmid. The protocol is very clear and the steps is pretty simple and fast. Site mutation is successfully created.

Q5 Site-Directed Mutagenesis Kit

Q5 Site-Directed Mutagenesis Kit from New England Biolabs

New England Biolabs

Citations (1258)

Reviews

Q5 Site-Directed Mutagenesis Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map