Q5 Site-Directed Mutagenesis Kit E0554S from New England Biolabs

Product Specs
ItemQ5 Site-Directed Mutagenesis Kit
CompanyNew England Biolabs
Price $215.00 Inquire
Catalog NumberE0554S
Quantity10 reactions
ApplicationsDNA Manipulation
TemperatureMulti-Temperature

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) The mRNA architecture of the translation termination site primes programmed stop codon readthrough events in DrosophilaRNA BiolDecember 31, 2026Laveena Kansara, Georg Wolfstetter, Daniel Wintermayr, Ioannis Alexopoulos, Alejandra Escos, Marc Friedländer, Ylva EngströmHk, yemanuclein, CG10321 and CG6282 genes were made with the Q5®-site directed mutagenesis kit (NEB, #E0554S) according to the manufacturer’s instructions. The Renilla luciferase control plasmid (Addgene #38093)

(2) Novel bispecific T-cell engagers overcoming acquired EGFR resistancemAbsDecember 1, 2026Kühl L, Löffler AK, Seifert O, Michler D, Kuhlmann M, Russo G, Kuhn P, Nowack H, Frenzel A, Schirrmann T, et al.Mutations in the ECD of human EGFR were introduced by site-directed mutagenesis (New England Biolabs #E0554S). Recombinant protein was isolated from supernatants using protein A resin (Fc-comprising molecules;

(3) Characterization of the intrinsic AmpC β-lactamase of Escherichia marmotae and its impact on decreased susceptibility to cefiderocol and resistance to broad-spectrum cephalosporinsJ Antimicrob ChemotherAugust 13, 2026Samanta Freire, Sandra Martinez Alvarez, Jacqueline Findlay, Miriam Vogel, Patrice Nordmann, Laurent Poirelextended spectrum of the EMC-2, site-directed mutagenesis using the Q5 Site-Directed Mutagenesis kit (ref. E0554S; New England Biolabs, Ipswich, MA, USA) was performed using EMC-1 as template, to generate deletion

(4) Functional dissection of HCMV gB’s autonomous fusion activity provides insights into how polymorphisms in clinical isolates confer distinct characteristicsmBioAugust 12, 2026Xiaohan Chen, Barbara Kropff, Jiawen Li, Heinrich Sticht, Madlen Mollik, Marie Sieger, Fulvia Ferrazzi, Irene Görzer, Michael Mach, Marco ThomasNew England Biolabs GmbH, Frankfurt am Main, Germany) or Q5 Site-Directed Mutagenesis Kit (Catalog #E0554S, New England Biolabs GmbH, Frankfurt am Main, Germany) with the pairs of primers listed in Table 1.

(5) Mechanism of K63-linked polyubiquitin recognition and cleavage by the BRCA1-A complexNat CommunAugust 11, 2026Martina Foglizzo, Arindam Datta, Oksana Degtjarik, Hirunika Perera, Jordan Liburd, Upasana M. Sykora, Sri Ranjani Ganji, Gemma Wildsmith, Francesca Chandler, Lisa J. Campbell, et al.27496)34, respectively, using Q5 Site-Directed Mutagenesis kit (New England Biolabs; catalogue number: E0554S) following the manufacturer’s protocol. BRCC45 mutants were generated by site-directed mutagenesis of

(6) Divergent C. elegans toxin alleles are suppressed by distinct mechanismsElifeAugust 11, 2026Stefan Zdraljevic, Laura Walter-McNeill, Giancarlo N Bruni, Joshua S Bloom, JB Collins, Daniel HW Leighton, Heriberto Marquez, Noah Alexander, Leonid Kruglyakfound in Supplementary file 3. pWM17 was generated using the NEB Q5 site-directed mutagenesis kit (#E0554S) using pWM11 as the template and primers oZ288 and oZ289. All plasmids were purified using the Invitrogen

(7) Human PMS1-dependent non-canonical mismatch repair engages with MBD4 to repair methylated CpG deaminationNucleic Acids ResAugust 11, 2026Anaïs Le Ven, Sandra Vanhuele, Olivier Ganier, Alexandre Houy, Amanda Kahn, Manuel Rodrigues, Marc-Henri Stern, Raphael Guerois, André Bortolini SilveiraCMV-YE1-BE3-FNLS-CMV-mCherry [30] (Addgene, #154005) was reengineered with the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). First, we removed its uracil glycosylase inhibitor, which was originally intended to inhibit BER and

(8) DNA Replication Stress-Induced Transcriptome of Human Burkitt's Lymphoma Identifies Reciprocal Regulation Between MBD1 and BCL6 During Germinal Center-Derived B-LymphomagenesisHematol OncolAugust 6, 2026Santosh Kumar Gothwal, Kyoko Oichai, Hongtae Kim, Kyungjae Myung, Jacqueline H. Barlowbinding motifs on the MBD1 promoter were constructed using the Q5 site‐directed mutagenesis kit (NEB# E0554S) and as per the manufacturer's instructions. Primers used for the site‐directed mutagenesis are listed

(9) Protocol to determine oligomerization states of proteins in living cells using photon counting histogram analysisSTAR ProtocAugust 5, 2026Zixiao Li, Tyler Camp, Yushan Li, Kai ZhangT4 DNA ligase,New England Biolabs,Cat#M0202S Q5 Site-Directed Mutagenesis Kit,New England Biolabs,Cat#E0554S InFusion HD Cloning Kit,"Takara Bio USA, Inc.",Cat#639650 "Atto655, free acid",ATTO-TEC GmbH,Cat#AD

(10) Environment-dependent epistasis shapes adaptation to fluctuating resourcesbioRxivAugust 4, 2026Ashlynn G. Bruder, Nathan Fiedeldey, Sarah B. Worthan, Zeer Cen, Megan G. Behringer5’-TCCTATTCTCTAGAAAGTAT-3’. This was accomplished using the NEB Q5 site-directed mutagenesis kit (product number: E0554S) to replace the original gRNA sequence present in the pTargetF plasmid (5’-CATCGCCGCAGCGGTTTCAG-3’),

(11) A self-complementary recombinant adeno-associated virus vector coding for an anchorless prion protein carrying the G127V mutation extends survival in a rodent prion disease modelPLoS PathogAugust 4, 2026Thomas Zerbes, Claire Verkuyl, Cunjie Zhang, Sophie Grunnesjoe, Shehab Eid, Hamza Arshad, Wenda Zhao, Zahra Nasser, Teaghan O'Shea, Ari Bel, et al.Basic Inc, Markham, ON, Canada). For MoPrnpV126, a Q5 Site-Directed Mutagenesis Kit (catalog number E0554S, New England Biolabs, Ipswitch, MA, USA) was deployed to exchange the mouse PrP signal peptide for ER

(12) Humans homozygous for rare or common hypomorphic IL23R variants are prone to tuberculosisJ Exp MedAugust 3, 2026Diana Olguín Calderón, Laura E. Kilpatrick, Clément Conil, Quentin Philippot, Masato Ogishi, Joseph Vellutini, Ji Eun Han, Narelle Keating, Hailun Li, Geetha Rao, et al.G300V and L372F were generated by site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (#E0554S; NEB) and the following primers: G300V: Forward primer: 5′-TCAAGAAACAGTGAAAAGGTACTGG-3′ Reverse

(13) A nuclear targeting approach enables efficient transgenesis in the milkweed bug Oncopeltus fasciatusbioRxivJuly 31, 2026Yu Shirai, Yousuf Hashmi, Ashley Watts, Jonchee A. Kao, Cassandra G. Extavour1×, 3×, or 5× NLS were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat#E0554S) according to the manufacturer’s protocol. Amino acid sequences of all hyPBase variants are provided

(14) An RNase domain-dependent microRNA detection with DNA-spiked nanocage for accurate cancer diagnosisNature CommunicationsJuly 29, 2026Hye Hyun Kim, Yong Hwan Seol, Dae Kwon Park, Young Eun Jang, Jeewon Leeconstructed. Two plasmid templates were mutated using the Q5® Site-Directed Mutagenesis Kit (Cat. No. E0554S; New England Biolabs, Ipswich, MA, USA) to generate (i) HBVCmAg(1–149), in which Cys48, Cys61 and Cys107

(15) Recurrent ZC3H18 mutations stabilize oncogenic endogenous retroviral RNACell ReportsJuly 28, 2026Tanzina Tanu, Anna M. Cox, Jennifer A. Karlow, Priyanka Sharma, Kaiwen Sun, Xueyang He, Swathy Babu, Madeline K. Roelofs, Ethan Jeon, Jiajia Chen, et al.was cloned with the R680Gfs*5 (hereafter Z18trunc) patient mutation using in vitro mutagenesis (NEB, E0554S). Gene fragments for the chr4:42592945 BHIKHARI-2 ERV (hereafter bhik-2–42) and chr4:37858940 BHIKHARI-2

(16) Fission yeast RPA–TERT–Tpz1 TPP1 complex promotes telomere extension and suppresses telomere recombinationbioRxivJuly 28, 2026Bettina A. Moser, Madeline Points, Sourav Agrawal, Adam C. Didier, Amanda K. Mennie, Ci Ji Lim, Yong-jie Xu, Toru M. Nakamurawith Q5 PCR (NEB, M0491L), Gibson Assembly (NEB, E5510S), or site-directed mutagenesis kits Q5 (NEB, E0554S) or QuikChange Lightning (Agilent, 210519) on plasmids carrying the gene of interest. All constructs

(17) PLA2G2F suppresses ferroptosis through phospholipid remodelingNature Structural & Molecular BiologyJuly 22, 2026Yingying Hu, Joleen Csuka, Presha Rajbhandari, Penghsuan Huang, Nicholas Carbone, Deguang Liang, Wei Gu, Alban Ordureau, Brent R. Stockwell, Xuejun Jiangwas made from the isoform 2 overexpression plasmid using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554s) with the following primers: PLA2G2F_H110Q_F (CTGCCACGCCCAGGACTGCTGCT) and PLA2G2F_H110Q_R (CACCAGTCCACCTCATCCTTGGG)

(18) EMT activates ER-to-Golgi trafficking through upregulation of REEP2 to promote lung cancer progressionResearchSquareJuly 22, 2026Guan-Yu Xiao, Oluwafunminiyi Obaleye, Oluwafunminiyi Obaleye, Shike Wang, Jiang Liu, Jonathan M. Kurie, Jonathan M Kurie, William K. Russell, Xiaochao Russell, Xiaochao Xiaothe Dual-Luciferase Reporter Assay System (Promega). Mutagenesis Q5 Site-Directed Mutagenesis Kit (#E0554S, NEB) was used to generate mutants according to the manufacturer’s instructions. The primer sequences

(19) Neuron-derived neurotrophic factor-positive interneurons: a cellular target for anti-seizure therapiesEBioMedicineJuly 21, 2026Amy Richardson, Marion S. Mercier, Yoshiteru Shimoda, Robert T. Graham, Marco Leite, Alejandro Garcia, Maud Muller, Suraya A. Bond, Maria Grozdanova, Qimin Wu, et al.hM3Dq transgene from the pAAV-mDlx-DIO-hM3Dq-mCherry plasmid using Q5 site-directed mutagenesis (NEB E0554S) with the primers Fwd—GGTGGCGCTAGCATAACTT and Rev—GCCACCATGGTGAGCAAG. Following PCR amplification and

(20) A novel RNA-binding activity of ECD contributes to U5 snRNP stability and pre-mRNA splicingNucleic Acids ResJuly 21, 2026Mohsin Raza, Asher Rajkumar Rajan, Achyuth Kalluchi, Bhopal Mohapatra, Irfana Saleem, Benjamin B Kennedy, Kishor K Bhakat, Hamid Band, M Jordan Rowley, Vimla Bandvector was created using a PCR (polymerase chain reaction)-based site-directed mutagenesis kit (NEB#E0554S), according to the manufacturer’s instructions. The primer sequences used for mutagenesis are listed

Write a Review

(1)

1/24/2024Mutagenesis Kit From New England Biolabs Enables Rapid, Site-Specific Mutagenesis of Double-Stranded Plasmid DNA Aditi KothariThe Q5 Site-Directed Mutagenesis Kit enables rapid, site-specific mutagenesis of double-stranded plasmid DNA in less than 2 hours. The kit utilizes the robust Q5 Hot Start High-Fidelity DNA Polymerase... Read Review
(1)

4/14/2023Great Kit for Site-Specific Mutation YONG MThe Q5® Site-Directed Mutagenesis Kit was purchased to create the point mutation in plasmid. The protocol is very clear and the steps is pretty simple and fast. Site mutation is successfully created.

Q5 Site-Directed Mutagenesis Kit

Q5 Site-Directed Mutagenesis Kit from New England Biolabs

New England Biolabs

Citations (1235)

Reviews

Q5 Site-Directed Mutagenesis Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map