Mouse IL-2 Secretion Assay – Detection Kit (APC) 130-090-987 from Miltenyi Biotec

(1) Cbl-b mitigates the responsiveness of naive CD8 + T cells that experience extensive tonic T cell receptor signalingScience SignalingFebruary 6, 2024Joel Eggert, Wendy M. Zinzow-Kramer, Yuesong Hu, Elizabeth M. Kolawole, Yuan-Li Tsai, Arthur Weiss, Brian D. Evavold, Khalid Salaita, Christopher D. Scharer, Byron B. Au-Yeung(Miltenyi Biotech, catalog #130-090-516) and the IL-2 Secretion Assay Kit (Miltenyi Biotech, catalog #130-090-987) after 16 hours of stimulation. Briefly, 1–1.5 × 105 T cells, including co-cultured T cell-depleted

(2) The lncRNA Malat1 inhibits miR-15/16 to enhance cytotoxic T cell activation and memory cell formationeLifeDecember 21, 2023Wheeler BD, Gagnon JD, Zhu WS, Muñoz-Sandoval P, Wong SK, Simeonov DS, Li Z, DeBarge R, Spitzer MH, Marson A, et al.kit,IFNγ ELISA,R&D Systems,MIF00, Commercial assay or kit,IL-2 Secretion Assay APC,Miltenyi Biotec,130-090-987, Sequence-based reagent,Malat1 CRISPR Guide 1,Dharmacon,RNA oligomer,Sequence – GCATTCTAATAGCAGCAGAT Sequence-based

(3) Accumulation of TCR signaling from self-antigens in naive CD8 T cells mitigates early responsivenessbioRxivFebruary 1, 2023Joel Eggert, Wendy M. Zinzow-Kramer, Yuesong Hu, Yuan-Li Tsai, Arthur Weiss, Khalid Salaita, Christopher D. Scharer, Byron B. Au-Yeung(Miltenyi Biotech, catalog #130-090-516) and the IL-2 Secretion Assay Kit (Miltenyi Biotech, catalog #130-090-987) after 16 hours of stimulation. Briefly, 1–1.5 × 105 T cells, including co-cultured T cell-depleted

(4) Adaptation by naïve CD4(+) T cells to self-antigen-dependent TCR signaling induces functional heterogeneity and toleranceProceedings of the National Academy of Sciences of the United States of AmericaJuly 23, 2019Zinzow-Kramer WM, Weiss A, Au-Yeung BB.Assay. Detection of IL-2 secreting cells was performed using the IL-2 secretion assay kit (catalog #130-090-987, Miltenyi) similar to methods previously described (39). Briefly, 2 × 105 T cells per condition were

(5) Long-peptide vaccination with driver gene mutations in p53 and Kras induces cancer mutation-specific effector as well as regulatory T cell responsesOncoimmunologyJanuary 1, 2018Quandt J, Schlude C, Bartoschek M, Will R, Cid-Arregui A, Schölch S, Reissfelder C, Weitz J, Schneider M, Wiemann S, et al.secretion assays Cytokine secretion assays (Miltenyi, Mouse IL-2 Secretion Assay Detection Kit (APC*) 130–090-987 Mouse IFN-γ Secretion Assay Detection Kit (PE) 130–090-516) were downscaled to a 96-well plate format

(6) AhR activation increases IL-2 production by alloreactive CD4(+) T cells initiating the differentiation of mucosal-homing Tim3(+) Lag3(+) Tr1 cellsEuropean journal of immunologyNovember 1, 2017Ehrlich AK, Pennington JM, Tilton S, Wang X, Marshall NB, Rohlman D, Funatake C, Punj S, O'Donnell E, Yu Z, et al.

(7) Early kinetic window of target T cell susceptibility to CD25+ regulatory T cell activityJournal of immunology (Baltimore, Md. : 1950)December 1, 2005Sojka DK, Hughson A, Sukiennicki TL, Fowell DJ.

(8) IL-2 secretion by CD4+ T cells in vivo is rapid, transient, and influenced by TCR-specific competitionJournal of immunology (Baltimore, Md. : 1950)May 15, 2004Sojka DK, Bruniquel D, Schwartz RH, Singh NJ.

(9) Immunoregulatory role of CD1d in the hydrocarbon oil-induced model of lupus nephritisJournal of immunology (Baltimore, Md. : 1950)August 15, 2003Yang JQ, Singh AK, Wilson MT, Satoh M, Stanic AK, Park JJ, Hong S, Gadola SD, Mizutani A, Kakumanu SR, et al.

(10) Sequential production of IL-2, IFN-gamma and IL-10 by individual staphylococcal enterotoxin B-activated T helper lymphocytesEuropean journal of immunologyMay 1, 1998Assenmacher M, Löhning M, Scheffold A, Manz RA, Schmitz J, Radbruch A.

Be the First to Write a Review!

Mouse IL-2 Secretion Assay – Detection Kit (APC) from Miltenyi Biotec

Miltenyi Biotec

Miltenyi Biotec

Citations (10)

Reviews

Mouse IL-2 Secretion Assay – Detection Kit (APC) from Miltenyi Biotec

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map