Fig 2: miR-23a/b suppress cGAS-mediated autoimmunity in mice. qPCR analysis of Cgas mRNA levels (a) and immunoblot analysis of cGAS protein levels (b) in the hearts and spleens of WT or Trex1-/- mice (n = 6 per group). c qPCR analysis of miR-23a/b levels in the hearts and spleens of WT and Trex1-/- mice (n = 6 per group). d Trex1-/- mice (n = 6 per group) were injected intraperitoneally with the indicated agomirs for 6 days, and the cGAS protein levels in the hearts and spleens were then analyzed by western blotting. e Trex1-/- mice (n = 6 per group) were treated as described in d, and the level of IRF3 phosphorylation in the spleens was then analyzed by western blotting. Trex1-/- mice (n = 6 per group) were treated as described in d, and the levels of Ifnb, Cxcl10, Isg15, and Isg56 mRNA in the hearts (f) and spleens (g) were then measured by qPCR. h Trex1-/- mice (n = 4 per group) were treated as described in d, and the amounts of cGAMP in the hearts and spleens were then measured by ELISA. i Representative H&E-stained heart sections of Trex1-/- mice treated as described in d. The images in the panels are at ×40 magnification. j Representative IHC staining for cGAS in heart and spleen sections of Trex1-/- mice treated as described in d. The images in the panels are at ×40 magnification. The data are representative of three independent experiments (mean ± SD). *p < 0.05, **p < 0.01

Fig 3: VP3 blocks IFN-ß production by inhibiting the activation of IRF3. (A and B) Inhibition of MDA5 (A)- or SeV (B)-mediated IRF3 promoter activation by Avibirnavirus VP3. Dual-luciferase assays were performed as described for Fig. 1A and B. (C and D) HEK293T cells were transfected with the expression plasmid of VP3 or an empty vector and with or without MDA5 for 36 h. Cells were then harvested. The levels of IRF3 dimers were subjected to IRF3 dimer gels (C), and the levels of p-IRF3 and total IRF3 in the cytoplasmic and nuclear fractions were subjected to Western blotting (D). GAPDH and LaminB1 were used as the cytoplasmic and nuclear fraction markers, respectively. Mono, monomer; WCL, whole-cell lysates; Cyto, cytoplasm. (E) Impact of VP3 knockdown on IBDV-driven IRF3 activation. HEK293T cells were infected with IBDV at an MOI of 10 for 1 h, and the RNAi sequence (GACGAAGUUGCCAAAGUCUAU) against VP3 was transfected into the resultant cells for another 23 h. The lysates were subjected to an immunoblotting assay with the indicated antibodies. Si-VP3, viral protein VP3 knockdown. (F) Effects of VP3 on MDA5-induced IFN-ß production. HEK293T cells were transfected with VP3 or an empty vector along with MDA5 for 36 h. The IFN-ß production in response to MDA5 was assessed with an ELISA kit. (G) Effects of VP3 on the transcription of the IFNB1 and ISGs genes. A vector expressing VP3 or an empty vector and MDA5 were transfected into HEK293T cells for 36 h, and then the mRNA levels of the IFNB1, Mx1, STAT1, ISG15, and ISG56 genes were detected by quantitative PCR. The transcript level of each gene was normalized to the expression of GAPDH. (H) VP3 knockdown promotes the transcription of chicken IRF7 induced by IBDV. The method is consistent with that described for Fig. 1F. The mRNA of chicken IRF7 was detected by qPCR. (I and J) Effects of VP3 on VSV-GFP replication. (I) HEK293T cells were transfected with an empty vector or a vector expressing VP3 protein along with MDA5 for 24 h, cells were infected with VSV-GFP for another 12 h, and virus replication was determined using fluorescence microscopy. PH, phase. (J) The supernatants from VSV-GFP-infected cells were harvested for viral titer detection. (K) Construction of DF-1 cells with stable expression of VP3. (L and M) VP3 overexpression inhibits IFN antiviral signaling in response to IBDV infection. Control and DF1-1 cells overexpressing VP3 were mock infected or IBDV infected. At different time points (0, 12, 21, 36, and 48 h) after IBDV infection, the cellular lysates and the supernatants were subjected to immunoblotting analysis and viral titer detection, respectively. PCDH, empty vector pDCH-CMV-MCS-EF1-Puro. (L and M) Expression levels of the viral structural protein VP1 and p-TBK1 were analyzed (L), and the TCID50 was used to assess IBDV replication (M). All data are presented as the means ± SD from three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001. ß-Actin expression served as a loading control.

Fig 4: AKT2 interacts with 14-3-3e and IRF3 to slack IFNß1 production (related to Fig 3) IFNß1 luciferase activity was measured (top panel, n = 3) in HEK293T cells transfected with indicated constructs. Immunoblot analysis showed the indicated constructs in HEK293T cells (bottom panels).Immunoblot analysis of IRF3 in HEK293T and HEK293T-IRF3 KO cells.qRT–PCR analysis for knockdown efficiency of Irf3 siRNAs (siIrf3-1 and siIrf3-2).WT and Akt2 KO PEMs were treated with or without VSV or HSV-1 for 6 h, and then, the Irf3 mRNA level was measured by qRT–PCR. n = 3, respectively.Schematic diagram of constructs expressing HA-tagged human AKT2, Flag-tagged human IRF3 and their mutants (left panel). HEK293T cells were co-transfected with indicated constructs for 24 h. Anti-HA and anti-Flag antibody-conjugated agarose beads were used for immunoprecipitation, and the interaction domain was mapped by immunoblot analysis with the indicated antibodies (right panel).Immunoassay of IRF3 in dimer or monomer form by native-gel and p-IRF3 (Ser396), p-TBK1 (Ser172), AKT2 and GAPDH by SDS-gel in WT and Akt2 KO PEMs with lipo-ISD stimulation for 6 h.Immunofluorescent microscopic imaging (left panel) and statistics analysis (right panel, n = 3) for IRF3 nuclear translocation in lipo-ISD stimulated WT and Akt2 KO PEMs. IRF3 (red), Nuclei (Hoechst, green). The white arrows indicate the nuclei with IRF3 translocation. Bar, 10 µm.Immunoprecipitation with anti-Myc antibody-conjugated agarose beads and immunoblot analysis about the interactions between HA-AKT2 and Myc-14-3-3? or Myc-14-3-3e in HEK293T cells after overexpression of indicated constructs for 24 h.The mRNA level of 14-3-3? (n = 4) was measured by qRT–PCR in WT PEMs transfected the two 14-3-3? siRNAs (si14-3-3?-1 and si14-3-3?-2) for 48 h (left panel). The mRNA level of Ifnb1 (n = 3) was determined by qRT–PCR in VSV-stimulated PEMs that were transfected with si14-3-3?-1 (middle panel). IFNß1 luciferase activity (n = 3) was measured in HEK293T cells after being transfected with empty vector or 14-3-3? for 24 h and treated with VSV for 6 h, and immunoblot analysis showed the indicated constructs (right panel).The functional verifications of 14-3-3e (left and right panels) as those of 14-3-3? in Fig EV3I (left and middle panels, respectively).HEK293T cells were transfected with Flag-IRF3, HA-AKT2, and Myc-14-3-3e. 24 h post-transfection, cells were collected and subjected to immunoprecipitation (anti-Flag antibody-conjugated agarose beads) and immunoblot.Immunoassay of the p-IRF3 (Ser396) and dimerization of IRF3 in HEK293T cells with the overexpression of the indicated plasmids. Data information: *P < 0.05, **P < 0.01 and ns, not significant (P > 0.05); using a one-way ANOVA test (A left panel, I right panel) or two-way ANOVA test (D, G right panel, I middle panel and J right panel). Data are from at least three independent experiments (A left panel, D, G right panel, I and J) or representative of three independent biological replicates (A right panel, B, C, E right panel, F, G left panel, H, K and L). Error bars (A left panel, D, G right panel, I and J, mean ± SEM; A right panel and C, mean ± SD). Source data are available online for this figure.

Fig 5: Depletion of histone deacetylase 1 (HDAC1) inhibited influenza A viruses (IAV) infection through activation the TBK1-IRF3 and ERK signaling pathways. A549 knockdown HDAC1 stable cells and control cells (shCONT) were infected with rWT/rK103A/rK103R virus at an MOI of 1 for 24 h. (A–E) The relative expression level of nucleoprotein (NP) (A), HDAC1 (B), IFNa (C), IL6 (D), and TLR3 (E) were determined by qRT-PCR. (F) Total lysate of the infected cells was subjected for Western blot analysis of viral NP, Ace-NP, HDAC1, p-IRF3, IRF3, p-TBK1, TBK1, p-ERK, and ERK. ß-actin was used as a loading control. (G) The relative Ace-NP expression level equal to the Ace-NP level divided by the total NP. *P < 0.05; **P < 0.01, ***P < 0.001 (analysis of two-way ANOVA followed by Bonferroni post-test). Data are representative of three independent experiments [mean ± SD in (A–E)].