Fig 2: QKI-5 cooperates with SREBP2 at promoters genome-wide in lens cells.a Immunoblots of QKI-5 in subcellular fractions of WT and QKI KO HLE-B3 cells. GAPDH: cytosol; SP1: nuclei; Histone H3: chromatin. The result was repeated three times. b, c Co-IP of HLE-B3 cells overexpressing QKI-5–HA and Flag-SREBP2 with b anti–QKI-5 antibody blotting with anti-Flag and –QKI-5 antibodies and c anti-SREBP2 antibody blotting with anti-HA and -SREBP2 antibodies. mSREBP2: mature SREBP2. The results were repeated three times. d, e Co-IP of NLPCs overexpressing Flag-Srebp2 with d anti–Qki-5 antibody blotting with anti-Flag and –Qki-5 antibodies and e anti-Srebp2 antibody blotting with anti–Qki-5 and -Srebp2 antibodies. The results were repeated three times. f Genomic annotation of genome or Qki-5–, Srebp2-, and Pol II-binding sites from ChIP-seq in NLPCs. Promoters are confined to the regions of ±2 kb from the TSS. g Heatmap of Qki-5, Srebp2, and Pol II ChIP-seq and input signals within ±2.5 kb from the TSS regions for all promoters (n = 24,776) in NLPCs ranked by Qki-5 density. h Signalplots showing the read counts per million mapped reads (RPM) for Qki-5, Srebp2, and Pol II ChIP-seq data and input ±2.5 kb from the TSS of all promoter regions (n = 24,776) in NLPCs.

Fig 3: Disruption of PAQR3 interaction with Scap/SREBP by a synthetic peptide effectively blunts SREBP activity and lipid biosynthesis in the liver.(a,b) A synthetic peptide P6–55 blocks the interaction of PAQR3 with Scap and SREBP-2. HEK293T cells were transfected with the plasmids as indicated. At 24 h after transfection, the cells were treated with P6–55 (1, 4 or 20 ng μl−1) for 12 h and the cell lysate was used for immunoblotting (IB) and immunoprecipitation (IP) using the indicated antibodies. (c) P6–55 reduces SREBP activation. CHO-7 cell was transfected with Flag-tagged SREBP-2. At 6 h after transfection, the cells were treated with P6–55 (4 or 20 ng μl−1) in normal medium or LD medium for 16 h, and the cell lysate was used in western blotting with the indicated antibodies. (d) P6–55 decreases lipid-synthesizing gene expression in cells. CHO-7 cells were treated with control peptide or P6–55 (20 ng μl−1) for 96 h and then used in RT–PCR. (e,f) P6–55 alleviates PAQR3-mediated Golgi localization of Scap. HeLa cells were transiently transfected with PAQR3 and Scap. After culturing in normal medium for 48 h, the cells were treated with 20 ng μl−1 of control peptide or P6–55 for 12 h before immunofluorescence staining and confocal analysis. The nuclei were stained with Hoechst 33342 (only shown in the merged images). The arrows denote co-localization of PAQR3 with Scap in the GA. The arrowheads indicate apparent loss of co-localization of PAQR3 with Scap in the GA. Quantitation of the co-localization of the proteins in the GA is shown in f. (g–i) P6–55 shuts down SREBP activation and cholesterol synthesis in the liver. Western blotting analysis, gene expression analysis and lipid levels in the livers of mice (n=7 per group) treated with a control peptide or P6–55 (500 μg kg−1 per day) for 14 days. All bars show mean±s.d., *P<0.05, **P<0.01, ***P<0.001 by Student's t-test; NS, not significant. Scale bar, 10 μm. All experiments were repeated at least twice with similar results and representative data are shown.

Fig 4: Primary miR-33a and SREBP2 mRNA are upregulated by anti-ApoA-1 IgG. Cells were treated with anti-ApoA-1 IgG or control antibodies for 24 h and RT-PCR was performed to determine pri-miR-33a and SREBP2 mRNA levels (a,b). Data are expressed as fold change expression of the mean ± SD of pri-miR-33a or SREBP2 mRNA calculated by ΔΔCT method of five independent experiments (n = 5) and values were normalized to untreated condition. p-values were calculated using the Student’s t-test. (a), * p = 0.032, ** p = 0.0031; (b), * p = 0.043, ** p = 0.007.

Fig 5: Qki-5 interacts with ssDNA.a Schematic of the MST assay of bacterially expressed recombinant Qki-5 and QRE. The image of MST machine (Monolith NT.115) is from https://nanotempertech.com/monolith. The titration curve for the MST assay for fluorescently labeled Trx-His6–Qki-5 (full-length) and QRE1 (CUUCUUAAUAUAACUGCCUUAAACUUUAAU) is shown at right (n = 3). The results are presented as means with SD. b Schematic for designing the QDEs proximally downstream of SREs in the promoter regions of cholesterol biosynthesis genes used for the MST assay to examine the interaction with Qki-5. c The ssDNA oligos (QDE and QDE-m [mutant]) tested in the MST assay and the Kd value of each oligo in the assay. d Titration curves for the MST assay showing the Kd values for fluorescently labeled Trx-His6-Qki-5 (full-length) (fraction of 20 nM protein bound by DNA, y-axis) and QDE/QDE-m (2-fold serially diluted 16 different concentrations (M), x-axis). n = 3/group. The results are presented as means with SD. e Schematic diagram depicting proposed mechanisms by which Qki-5 cooperates with Srebp2 to enhance transcription of cholesterol biosynthesis, which maintains proper sterol levels to ensure protein homeostasis in eye lens cells and prevent cataracts.