STAT5a/b Pan Specific Antibody AF2168 from R&D Systems, a Bio-Techne Brand

Product Specs
ItemSTAT5a/b Pan Specific Antibody
CompanyR&D Systems, a Bio-Techne Brand
Price $429.00Supplier Page View Company Product Page
Catalog NumberAF2168
ApplicationsFlow Cytometry,Western Blot,Simple Western,Neutralization,Chromatin Immunoprecipitation (ChIP),Functional Assay
Conjugate/TagUnconjugated
FormatLyophilized from a 0.2 µm filtered solution in PBS with Trehalose. *Small pack size (SP) is supplied either lyophilized or as a 0.2 µm filtered solution in PBS
IsotypeIgG
Quantity100 ug (also 25 ug)
TargetSTAT5a/b
HostRabbit
ReactivityHuman,Mouse
ClonalityPolyclonal
ImmunogenHuman STAT5a and STAT5b synthetic peptide, aa 219-390
ConcentrationLYOPH
PurityAntigen Affinity-purified
Antibody TypePrimary Antibodies
StorageUse a manual defrost freezer and avoid repeated freeze-thaw cycles. 12 months from date of receipt, -20 to -70 °C as supplied. 1 month, 2 to 8 °C under sterile conditions after reconstitution. 6 months, -20 to -70 °C under sterile conditions after reconstitution
NCBI Full Gene Namesignal transducer and activator of transcription 5A
NCBI Gene AliasesMGF, STAT5

Specifications/Features

Available conjugates: Available conjugates: Unconjugated

Specificity: Detects endogenous human and mouse STAT5A and STAT5B in Western blots.

Sizes Available: 100 ug (also 25 ug)

Add to Compare List

R&D Systems, a Bio-Techne Brand

614 McKinley Place N.E.

Minneapolis, Minnesota 55413

United States

Phone: 1 (800) 343-7475
1 (612) 379-2956

Fax: 1 (612) 656-4400

Company Profile

Website: http://www.rndsystems.com

(1) Robust regulatory interplay of enhancers, facilitators, and promoters in a native chromatin contextCellJuly 17, 2026Zhou Zhou, Yang Cheng, Jaret Lieberth, Junke Zhang, Yiyang Jin, Albert Li, Haiyuan Yu, Abdullah Ozer, John T. Lisfollowing antibodies were used for IP: GATA1, Abcam ab11852; RUNX1, Abcam ab23980; STAT5, R&D Systems AF2168; p300, Abcam ab14984; normal rabbit IgG control, Cell Signaling Technology 2729S; normal mouse IgG1

(2) Robust regulatory interplay of enhancers, facilitators, and promoters in a native chromatin contextbioRxivFebruary 25, 2026Zhou Zhou, Albert Li, Junke Zhang, Haiyuan Yu, Abdullah Ozer, John T. Lisfollowing antibodies were used for IP: GATA1, Abcam ab11852; RUNX1, Abcam ab23980; STAT5, R&D Systems AF2168; p300, Abcam ab14984; normal rabbit IgG control, Cell Signaling Technology 2729S; normal mouse IgG1

(3) Eradication of Therapy-Resistant Cancer Stem Cells by Novel Telmisartan DerivativesJournal of Medicinal ChemistryJanuary 9, 2025Anna M. Schoepf, Maximilian Gebhart, Martin Federspiel, Isabel Heidegger, Martin Puhr, Madlen Hotze, Marcel Kwiatkowski, Andreas Pircher, Dominik Wolf, Sieghart Sopper, et al.to the manufacturer’s instructions at default settings. Antibodies specific to STAT5 (R&D Systems #AF2168; RRID/AB_355174), ABCB1 (Cell Signaling #12683; RRID/AB_2715689), ABCC1 (Cell Signaling #72202; RRID/AB_2799816),

(4) Evaluation of Roasting and Grilling Effects on Chemical Composition, Volatile Profiles, and Toxicity of Stink Bugs (Tessaratoma papillosa): Implications for Utilization as Functional Food IngredientsFoods (Basel, Switzerland)August 15, 2023Li H, Chumroenphat T, Boonarsa P, Yahuafai J, Wrigley C, Siriamornpun S.this study were Anti-JAK2 (NBP2-59451; Novus Biologicals, LLC, Littleton, CO, USA) and anti-STAT5 (AF2168; R&D System, Minneapolis, MN, USA). To ensure accurate protein loading, total protein was normalized

(5) Structure and function of a dual antagonist of the human growth hormone and prolactin receptors with site-specific PEG conjugatesThe Journal of biological chemistryAugust 1, 2023Basu R, Brody R, Sandbhor U, Kulkarni P, Davis E, Swegan D, Caggiano LJ, Brenya E, Neggers S, Kopchick JJ.

(6) Batf stabilizes Th17 cell development via impaired Stat5 recruitment of Ets1-Runx1 complexesThe EMBO journalApril 17, 2023Pham D, Silberger DJ, Nguyen KN, Gao M, Weaver CT, Hatton RD.anti‐H3K27ac [abcam, ab4729], rabbit anti‐Stat3 [Millipore, 06‐596], rabbit anti‐Stat5 [R&D Systems, AF2168], and normal rabbit IgG [Millipore, 12–370]) were coupled to Dynabeads M‐280 Sheep anti‐rabbit IgG (Thermo Fisher Scientific

(7) Aiolos represses CD4(+) T cell cytotoxic programming via reciprocal regulation of T(FH) transcription factors and IL-2 sensitivityNature communicationsMarch 24, 2023Read KA, Jones DM, Pokhrel S, Hales EDS, Varkey A, Tuazon JA, Eisele CD, Abdouni O, Saadey A, Leonard MR, et al.

(8) Whole-genome analysis of TET dioxygenase function in regulatory T cellsEMBO reportsAugust 4, 2021Yue X, Samaniego-Castruita D, González-Avalos E, Li X, Barwick BG, Rao A.centrifugation at 4°C. Protein G magnetic beads were pre‐loaded with 5 μg of anti‐STAT5A/B antibody (AF2168; R&D Systems) and incubated with the chromatin (pre‐cleared with Protein G magnetic beads) overnight

(9) Deconvoluting global cytokine signaling networks in natural killer cellsNature immunologyMay 1, 2021Wiedemann GM, Santosa EK, Grassmann S, Sheppard S, Le Luduec JB, Adams NM, Dang C, Hsu KC, Sun JC, Lau CM.anti-trimethyl-histone H3 (Lys4) antibody (H3K4me3, Millipore, 07-473) or 8 μg anti-STAT5 (R&D Systems, AF2168) and Dynabeads Protein G (Invitrogen). Immunoprecipitated DNA was quantified by PicoGreen and the size

(10) Tackling resistance in chronic myeloid leukemia: Novel cell death modulators with improved efficacyEuropean journal of medicinal chemistryApril 15, 2021Schoepf AM, Salcher S, Obexer P, Gust R.

(11) Lack of NFATc1 SUMOylation prevents autoimmunity and alloreactivityThe Journal of experimental medicineJanuary 4, 2021Xiao Y, Qureischi M, Dietz L, Vaeth M, Vallabhapurapu SD, Klein-Hessling S, Klein M, Liang C, König A, Serfling E, et al.PharMingen), anti-IgG (BD PharMingen), rabbit polyclonal H3-Ac (39139; Active Motif), rabbit anti-STAT5 (AF2168; R&D Systems), or rabbit IgG (02-6102; Thermo Fisher Scientific) overnight at 4°C and protein A/G Magnetic

(12) Alprazolam Prompts HIV-1 Transcriptional Reactivation and Enhances CTL Response Through RUNX1 Inhibition and STAT5 ActivationFrontiers in neurologyJanuary 1, 2021Lin A, Elbezanti WO, Schirling A, Ahmed A, Van Duyne R, Cocklin S, Klase Z.antibody (NM11) (Thermo scientific, MA5-13634). Human/Mouse STAT5a/b Pan Specific Antibody (R&D Systems, AF2168). Primers against HIV-1 U3 LTR were used for qPCR: F 5′CTAGCATTTCGTCACATGGCCCGAGA3′ R 5′GTGGGTTCCCTAGTTAGCCAGAG

(13) Divergent Role for STAT5 in the Adaptive Responses of Natural Killer CellsCell reportsDecember 15, 2020Wiedemann GM, Grassmann S, Lau CM, Rapp M, Villarino AV, Friedrich C, Gasteiger G, O'Shea JJ, Sun JC.min. Chromatin was sheared using a Covaris ultrasonicator. ChIP was performed using 8 μg anti-Stat5 (#AF2168, R&D Systems) and Dynabeads Protein G (Invitrogen). Immunoprecipitated DNA was quantified by PicoGreen

(14) Benzodiazepines Drive Alteration of Chromatin at the Integrated HIV-1 LTRVirusesFebruary 9, 2020Elbezanti W, Lin A, Schirling A, Jackson A, Marshall M, Duyne RV, Maldarelli F, Sardo L, Klase Z.(MA5-13634, Thermo Fisher Scientific, Waltham, MA, USA), Human/Mouse STAT5a/b Pan Specific Antibody (AF2168, R&D Systems, Minneapolis, MN, USA), RUNX1/AML1 (ab23980, Abcam, Cambridge, UK), CBF-β (ab167382, Abcam,

(15) Ikaros antagonizes DNA binding by STAT5 in pre-B cellsPloS oneJanuary 1, 2020Heizmann B, Le Gras S, Simand C, Marchal P, Chan S, Kastner P.polyclonal antibody against the C-terminal region of murine Ikaros, made in-house)] or anti-STAT5 [5 μg AF2168 (R&D System) or 5 μg ab7969 (Abcam)]. Protein–DNA complexes were bound to 30 μl Protein A Magnetic Beads

(16) Elevated Prolactin during Pregnancy Drives a Phenotypic Switch in Mouse Hypothalamic Dopaminergic NeuronsCell reportsFebruary 12, 2019Yip SH, Romanò N, Gustafson P, Hodson DJ, Williams EJ, Kokay IC, Martin AO, Mollard P, Grattan DR, Bunn SJ.

(17) Group 1 Innate Lymphoid Cell Lineage Identity Is Determined by a cis-Regulatory Element Marked by a Long Non-coding RNAImmunitySeptember 19, 2017Mowel WK, McCright SJ, Kotzin JJ, Collet MA, Uyar A, Chen X, DeLaney A, Spencer SP, Virtue AT, Yang E, et al.with 1.5μg of anti-H3K27ac (ab4729; Abcam), anti-H3K36me3 (ab9050; Abcam), or 5μg of anti-STAT5A/B (AF2168; R&D Systems) and incubated with the chromatin overnight at 4°C. Beads were washed once in low salt

(18) Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complexPLoS pathogensMay 1, 2017Ganaie SS, Zou W, Xu P, Deng X, Kleiboeker S, Qiu J.anti-pSTAT5(Y694) (cat# 4322) were from Cell Signaling (Danvers, MA); anti-STAT5a/b pan-specific antibody (cat # AF2168) and normal IgG rabbit (cat# AB-105-C) were from R&D Systems Inc (Minneapolis, MN); anti-MCM5 antibody

(19) Identification of Novel STAT6-Regulated Proteins in Mouse B Cells by Comparative Transcriptome and Proteome AnalysisJournal of immunology (Baltimore, Md. : 1950)May 1, 2017Mokada-Gopal L, Boeser A, Lehmann CHK, Drepper F, Dudziak D, Warscheid B, Voehringer D.Syk (product no. 2712, 1:1000; both from Cell Signaling Technology, Danvers, MA), STAT5a/b (cat. no. AF2168, 1 mg/ml; R&D Systems), or b-actin (13E5, 1:1000; Cell Signaling Technology). HRPconjugated Donkey Anti-Rabbit

(20) STAT5 Orchestrates Local Epigenetic Changes for Chromatin Accessibility and Rearrangements by Direct Binding to the TCRγ LocusJournal of immunology (Baltimore, Md. : 1950)August 15, 2015Wagatsuma K, Tani-ichi S, Liang B, Shitara S, Ishihara K, Abe M, Miyachi H, Kitano S, Hara T, Nanno M, et al.

Be the First to Write a Review!

STAT5a/b Pan Specific Antibody

STAT5a/b Pan Specific Antibody

STAT5a/b Pan Specific Antibody

STAT5a/b Pan Specific Antibody

STAT5a/b Pan Specific Antibody

STAT5a/b Pan Specific Antibody from R&D Systems, a Bio-Techne Brand

Specifications/Features

R&D Systems, a Bio-Techne Brand

Citations (33)

Reviews

STAT5a/b Pan Specific Antibody from R&D Systems, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map