GLP-1R Antibody - BSA Free NLS1205 from Novus Biologicals, a Bio-Techne Brand

Product Specs
ItemGLP-1R Antibody - BSA Free
CompanyNovus Biologicals, a Bio-Techne Brand
Price $329.00Supplier Page View Company Product Page
Catalog NumberNLS1205
ImmunogenA synthetic peptide made to an N-terminal extracellular portion of the human GLP1R protein (between residues 100-200). [UniProt P43220]
Concentration1.0 mg/ml
Quantity0.05 ml (also 0.025 ml)
HostRabbit
ApplicationsImmunohistochemistry,Western Blot,Immunohistochemistry-Paraffin,Microarray,Simple Western,Immunocytochemistry/ Immunofluorescence
TargetGLP-1R
Conjugate/TagUnconjugated
ReactivityHuman,Mouse,Rat
FormatPBS
NCBI Full Gene Nameglucagon like peptide 1 receptor, glucagon-like peptide 1 receptor
ClonalityPolyclonal
NCBI Gene AliasesGLP-1, GLP1Rc, GLP-1-R, GLP-1R
PurityImmunogen affinity purified
Molecular Weight53 kDa
Research AreaCancer, GPCR, Signal Transduction
IsotypeIgG
Antibody TypePrimary Antibodies
StorageStore at 4C short term. Aliquot and store at -80C long term. Avoid freeze-thaw cycles

Specifications/Features

Available conjugates: Available conjugates: Unconjugated

Sizes Available: 0.05 ml (also 0.025 ml)

Add to Compare List

Novus Biologicals, a Bio-Techne Brand

United States: 10771 E Easter Ave

Centennial, Colorado 80112

United States

Phone:
303-730-1950
888-506-6887

Email: novus@novusbio.com

Company Profile

Website: https://www.novusbio.com

(1) Functional human gastrointestinal organoids can be engineered from three primary germ layers derived separately from pluripotent stem cellsCell stem cellJanuary 6, 2022Eicher AK, Kechele DO, Sundaram N, Berns HM, Poling HM, Haines LE, Sanchez JG, Kishimoto K, Krishnamurthy M, Han L, et al.,Santa Cruz Biotechnology,#sc-10368 rabbit anti-Glucagon-like peptide-1 receptor (GLP-1R),Novus Biologicals,#NLS1205 rabbit anti-Histamine,Immunostar,#22939 rat anti-Keratin 8 (KRT8),Developmental Studies Hybridoma

(2) "Immunohistochemical, apoptotic and biochemical changes by dipeptidyl peptidase-4 inhibitor-sitagliptin in type-2 diabetic rats"Pharmacological reports : PRJanuary 1, 0001"Karabulut S, Coskun ZM, Bolkent S."

(3) Beneficial endocrine but adverse exocrine effects of sitagliptin in the human islet amyloid polypeptide transgenic rat model of type 2 diabetes: interactions with metforminDiabetesJanuary 1, 0001"Matveyenko AV, Dry S, Cox HI, Moshtaghian A, Gurlo T, Galasso R, Butler AE, Butler PC."

(4) Paired box 6 gene delivery preserves beta cells and improves islet transplantation efficacyEMBO molecular medicineJanuary 1, 0001"So WY, Liao Y, Liu WN, Rutter GA, Han W."4292, Cell Signaling Technology), PI3K110α (1/1,000, 4255, Cell Signaling Technology), GLP1R (1/1,000, NLS1205, Novus Biologicals, Littleton, CO, USA), GIPR (1/1,000, ab198694 and 1/1,000, ab136266, Abcam), phospho‐Akt

(5) Decreased glucagon-like peptide 1 receptor expression in endothelial and smooth muscle cells in diabetic db/db mice: TCF7L2 is a possible regulator of the vascular glucagon-like peptide 1 receptorDiabetes & vascular disease researchJanuary 1, 0001"Kimura T, Obata A, Shimoda M, Okauchi S, Hirukawa H, Kohara K, Kinoshita T, Nogami Y, Nakanishi S, Mune T, et al."CTGGCCCTACCAAGATGGTTAT Immunostaining We performed immunostaining using anti-GLP-1 receptor antibody (NLS1205; NOVUS Biologicals, Minneapolis, MN, USA). The sections in citrate buffer solution were heated for 15

(6) GLP-1 RA Improves Diabetic Retinopathy by Protecting the Blood-Retinal Barrier through GLP-1R-ROCK-p-MLC Signaling PathwayJournal of diabetes researchJanuary 1, 0001"Wei L, Mo W, Lan S, Yang H, Huang Z, Liang X, Li L, Xian J, Xie X, Qin Y, et al."the eye and fixation, the retinal tissue was sectioned with GLP-1R (Novus, Colorado, USA, Cat. No. NLS1205, 1 : 50), ROCK1, MMP-9, VEGF (Proteintech, Wuhan, China, Cat. No. 21850-1-AP, 1 : 2000), p-MLC (Bioss,

(7) "Exendin-4, a GLP-1 receptor agonist regulates retinal capillary tone and restores microvascular patency after ischaemia-reperfusion injury"British journal of pharmacologyJanuary 1, 0001"Zhai R, Xu H, Hu F, Wu J, Kong X, Sun X."ab199956, Abcam), p‐eNOS (1:50, Cat#9571S, RRID:AB_329837, Cell Signalling Technology), GLP‐1R (1:50, Cat# NLS1205, RRID:AB_2110043, NOVUS), Akt (1:50, Cat# 9272, RRID:AB_329827, Cell Signalling Technology), and PI3K

Be the First to Write a Review!

GLP-1R Antibody - BSA Free

GLP-1R Antibody - BSA Free

GLP-1R Antibody - BSA Free

GLP-1R Antibody - BSA Free

GLP-1R Antibody - BSA Free

GLP-1R Antibody - BSA Free from Novus Biologicals, a Bio-Techne Brand

Specifications/Features

Novus Biologicals, a Bio-Techne Brand

Citations (7)

Reviews

GLP-1R Antibody - BSA Free from Novus Biologicals, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map