Proprotein Convertase 9/PCSK9 Antibody AF3985 from R&D Systems, a Bio-Techne Brand

Product Specs
ItemProprotein Convertase 9/PCSK9 Antibody
CompanyR&D Systems, a Bio-Techne Brand
Price $499.00Supplier Page View Company Product Page
Catalog NumberAF3985
NCBI Gene AliasesPC9, FHCL3, FH3, HCHOLA3, NARC1, LDLCQ1, Narc1, NARC-1
ReactivityHamster,Human,Mouse,Rat,Transgenic Mouse
ApplicationsWestern Blot,In vivo assay,Simple Western,Immunocytochemistry
Conjugate/TagUnconjugated
TargetProprotein Convertase 9/PCSK9
Quantity100 ug (also 25 ug)
HostGoat
IsotypeIgG
NCBI Full Gene Nameproprotein convertase subtilisin/kexin type 9
ClonalityPolyclonal
FormatLyophilized from a 0.2 µm filtered solution in PBS with Trehalose. *Small pack size (SP) is supplied either lyophilized or as a 0.2 µm filtered solution in PBS
ImmunogenMouse myeloma cell line NS0-derived recombinant mouse Proprotein Convertase 9, Ser156-Gln694, Accession # Q80W65
ConcentrationLYOPH
PurityAntigen Affinity-purified
Antibody TypePrimary Antibodies
StorageUse a manual defrost freezer and avoid repeated freeze-thaw cycles. 12 months from date of receipt, -20 to -70 °C as supplied. 1 month, 2 to 8 °C under sterile conditions after reconstitution. 6 months, -20 to -70 °C under sterile conditions after reconstitution

Specifications/Features

Available conjugates: Available conjugates: Unconjugated

Specificity: Detects mouse and rat Proprotein Convertase 9/PCSK9 in direct ELISAs and Western blots.

Sizes Available: 100 ug (also 25 ug)

Add to Compare List

R&D Systems, a Bio-Techne Brand

614 McKinley Place N.E.

Minneapolis, Minnesota 55413

United States

Phone: 1 (800) 343-7475
1 (612) 379-2956

Fax: 1 (612) 656-4400

Company Profile

Website: http://www.rndsystems.com

(1) Sirtuin-1 directly binds and deacetylates hepatic PCSK9 thereby promoting the inhibition of LDL receptor degradationCardiovascular researchAugust 14, 2025Velagapudi S, Miranda MX, Adla P, Kraler S, Mohammed SA, Baki S, Robert J, Rohrer L, Lee H, Jang HD, et al.expression in Huh7 cells (1:1000 dilution, ab181142, Abcam), PCSK9 in mouse lysate (1:1000 dilution, AF3985, R&D systems). Membranes were incubated for 1 h with HRP-conjugated secondary antibody (Southern Biotechnology)

(2) Methionine Metabolism Dictates PCSK9 Expression and Antitumor Potency of PD-1 Blockade in MSS Colorectal CancerAdvanced science (Weinheim, Baden-Wurttemberg, Germany)May 1, 2025Wang QL, Chen Z, Lu X, Lin H, Feng H, Weng N, Chen L, Liu M, Long L, Huang L, et al.PCSK9 (EPR7627(2)), DNMT1 (EPR18453), and H3K4me3 (ab8580) were from Abcam, antibody to mouse PCSK9 (AF3985) were from R&D Systems, antibody to Flag (F1804) was from Sigma‐Aldrich, antibody to β‐actin (C4) was

(3) A commonly inherited human PCSK9 germline variant drives breast cancer metastasis via LRP1 receptorCellJanuary 23, 2025Mei W, Faraj Tabrizi S, Godina C, Lovisa AF, Isaksson K, Jernström H, Tavazoie SF.sc-7298), mouse anti-TUBULIN (1:10000; Cell Signaling, 3873), goat anti-PCSK9 (1:400; R and D Systems; AF3985), rabbit anti-PCSK9 (1:1000; GeneTex, GTX129859), rabbit anti-LRP1 (1:20000; Abcam, EPR3724), rabbit

(4) Geranylgeranyl isoprenoids and hepatic Rap1a regulate basal and statin-induced expression of PCSK9Journal of Lipid ResearchMarch 1, 2024Yating Wang, Brea Tinsley, Stefano Spolitu, John A. Zadroga, Heena Agarwal, Amesh K. Sarecha, Lale Ozcanantibodies were from Cell Signaling Technology. Anti-PCSK9 antibody was from R&D Systems (catalog no.: AF3985). AAV8-shRNA targeting murine Pggt1b was made by annealing complementary oligonucleotides 5′-CACCAAAGCCATCAGCTACATTAGAAGAAGTCAAGAGCTTCTTCTAATGTAGCTGATGGCTT

(5) Geranylgeranyl Isoprenoids and Hepatic Rap1a Regulate Basal and Statin-Induced Expression of PCSK9bioRxiv : the preprint server for biologyOctober 23, 2023Wang Y, Tinsley B, Spolitu S, Zadroga JA, Agarwal H, Sarecha AK, Ozcan L.antibodies were from Cell Signaling Technology. Anti-PCSK9 antibody was from R&D Systems (catalog no.: AF3985). AAV8-shRNA targeting murine Pggt1b was made by annealing complementary oligonucleotides 5′-CACCAAAGCCATCAGCTACATTAGAAGAAGTCAAGAGCTTCTTCTAATGTAGCTGATGGCTT

(6) Engineering of efficiency-enhanced Cas9 and base editors with improved gene therapy efficaciesMolecular TherapyMarch 1, 2023Shuming Yin, Mei Zhang, Yang Liu, Xiaoyue Sun, Yuting Guan, Xi Chen, Lei Yang, Yanan Huo, Jing Yang, Xiaohui Zhang, et al.protein was loaded on a 12% SDS-PAGE gel, and Pcsk9 protein was determined by anti-Pcsk9 (R&D Systems, #AF3985). β-Actin protein was taken as a loading control and determined by anti-β-actin (Cell Signaling Technology,

(7) Consumption of salmon fishmeal increases hepatic cholesterol content in obese C57BL/6 J miceEuropean journal of nutritionDecember 1, 2022Hjorth M, Doncheva A, Norheim F, Ulven SM, Holven KB, Sæther T, Dalen KT.antibodies. Primary antibodies used were as follows: Goat anti-Ldlr (#AF2255, R&D Systems), goat anti-Pcsk9 (#AF3985, R&D Systems, Minneapolis, MN, US), rabbit anti-Hmgcr (#PA5-37,367, Thermo Fisher Scientific, Waltham,

(8) Platelet-Derived PCSK9 Is Associated with LDL Metabolism and Modulates Atherothrombotic Mechanisms in Coronary Artery DiseaseInternational journal of molecular sciencesOctober 16, 2021Petersen-Uribe Á, Kremser M, Rohlfing AK, Castor T, Kolb K, Dicenta V, Emschermann F, Li B, Borst O, Rath D, et al.endarterectomy specimen. Immunohistochemical staining for PCSK9 (anti-m/rPC9 affinity-purified goat IgG, AF3985, R&D Systems/BioTechne, Minneapolis, MN, USA), CD68 (anti-human mouse monoclonal IgG F1118, Santa Cruz

(9) In vivo adenine base editing of PCSK9 in macaques reduces LDL cholesterol levelsNature biotechnologyAugust 1, 2021Rothgangl T, Dennis MK, Lin PJC, Oka R, Witzigmann D, Villiger L, Qi W, Hruzova M, Kissling L, Lenggenhager D, et al.

(10) Liver Pyruvate Kinase Promotes NAFLD/NASH in Both Mice and Humans in a Sex-Specific MannerCellular and molecular gastroenterology and hepatologyJanuary 1, 2021Chella Krishnan K, Floyd RR, Sabir S, Jayasekera DW, Leon-Mimila PV, Jones AE, Cortez AA, Shravah V, Péterfy M, Stiles L, et al.rabbit polyclonal PKLR (ThermoFisher #PA5-79824; Waltham, MA), goat polyclonal PCSK9 (R&D Systems #AF3985; Minneapolis, MN), goat polyclonal LDLR (R&D Systems #AF2255), mouse polyclonal PNPLA3 (Abcam # ab69170;

(11) Autocrine effects of PCSK9 on cardiomyocytesBasic research in cardiologyNovember 10, 2020Wolf A, Kutsche HS, Schreckenberg R, Weber M, Li L, Rohrbach S, Schulz R, Schlüter KD.subsequently transferred to a nitrocellulose membrane. Anti-PCSK9 polyclonal antibody produced in goat (#AF3985, R&D Systems, Minnesota, USA) was used to detect the expression of PCSK9 protein. Glyceraldehyde 3-phosphate

(12) Up-regulation of PCSK9 gene expression and diminished level of LDL-receptor in rat liver as a potential cause of post-lipectomy hypercholesterolemiaMolecular and cellular biochemistryMay 1, 2019Dettlaff-Pokora A, Sucajtys-Szulc E, Sledzinski T.

(13) A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for In Vivo Genome EditingMolecular cellFebruary 21, 2019Edraki A, Mir A, Ibraheim R, Gainetdinov I, Yoon Y, Song CQ, Cao Y, Gallant J, Xue W, Rivera-Pérez JA, et al.membrane was incubated with rabbit anti-GAPDH (Abcam ab9485, 1:2,000) or goat anti-PCSK9 (R&D Systems AF3985, 1:400) antibodies overnight. Membranes were washed in TBST and incubated with horseradish peroxidase

(14) Hepatic Glucagon Signaling Regulates PCSK9 and Low-Density Lipoprotein CholesterolCirculation researchJanuary 4, 2019Spolitu S, Okamoto H, Dai W, Zadroga JA, Wittchen ES, Gromada J, Ozcan L.(catalog number 4068). Anti-PCSK9 antibody used for Western blotting was from R&D Systems (catalog number AF3985). Anti-Hsp90 (heat shock protein 90) antibody was from Cell Signaling Technology (catalog number 4877).

(15) AAV8-mediated overexpression of mPCSK9 in liver differs between male and female miceAtherosclerosisNovember 1, 2018Vozenilek AE, Blackburn CMR, Schilke RM, Chandran S, Castore R, Klein RL, Woolard MD.normalized to GAPDH for statistical analysis. Primary antibodies were as follows: anti-m/rPC9 (R&D Systems; AF3985), LDLR18, GAPDH (Cell Signaling; 2118S). Secondary antibodies were as follows: Rabbit Anti-Goat IgG

(16) All-in-one adeno-associated virus delivery and genome editing by Neisseria meningitidis Cas9 in vivoGenome biologySeptember 19, 2018Ibraheim R, Song CQ, Mir A, Amrani N, Xue W, Sontheimer EJ.Membranes were incubated with rabbit anti-GAPDH (Abcam ab9485, 1:2000) or goat anti-PCSK9 (R&D Systems AF3985, 1:400) antibodies overnight at 4 °C. Membranes were washed five times in TBST and incubated with horseradish

(17) γ-Secretase Inhibition Lowers Plasma Triglyceride-Rich Lipoproteins by Stabilizing the LDL ReceptorCell metabolismApril 3, 2018Kim K, Goldberg IJ, Graham MJ, Sundaram M, Bertaggia E, Lee SX, Qiang L, Haeusler RA, Metzger D, Chambon P, et al.mouse ApoC3 from Ionis; human ApoC3 (33A-R1a) from Academy Biomedical; human ApoB (MAB4124) and PCSK9 (AF3985) from R&D systems; ApoB (ab20737), LDLR (ab30532), Syndecan-1 (ab128936) from Abcam; and GFP (sc-9996)

(18) Heparan sulfate proteoglycans present PCSK9 to the LDL receptorNature communicationsSeptember 11, 2017Gustafsen C, Olsen D, Vilstrup J, Lund S, Reinhardt A, Wellner N, Larsen T, Andersen CBF, Weyer K, Li JP, et al.anti-GAPDH (Sigma Aldrich G8795, 1:2000), anti-beta actin (Sigma A5441, 1:5000), anti-PCSK9 (R&D Systems AF3985, 1:1000), anti-syndecan-1 (R&D AF3190, 1:1000), and immunostainings: anti-PCSK9 (R&D Systems AF3888,

(19) Up-regulation of liver Pcsk9 gene expression as a possible cause of hypercholesterolemia in experimental chronic renal failureMolecular and cellular biochemistryJanuary 1, 2016Sucajtys-Szulc E, Szolkiewicz M, Swierczynski J, Rutkowski B.(Millipore). The following antibodies were used: mouse/rat Proprotein Convertase 9 polyclonal antibody (AF3985, R@D SYSTEMS), polyclonal antibody against LDL-R (sc11826, Santa Cruz Biotechnology), polyclonal antibody against

(20) "Accumulation of cholesterol, triglycerides and ceramides in hepatocellular carcinomas of diethylnitrosamine injected mice"Lipids in health and diseaseJanuary 1, 0001"Haberl EM, Pohl R, Rein-Fischboeck L, Höring M, Krautbauer S, Liebisch G, Buechler C."NB-110-4148755) antibodies were from Novus Biologicals (Wiesbaden-Nordenstadt, Germany). The PCSK9 (order number: AF3985), LDL-receptor (order number: AF2255-SP) and p53 (order number: AF1355) antibodies were from R&D Systems

Be the First to Write a Review!

Proprotein Convertase 9/PCSK9 Antibody

Proprotein Convertase 9/PCSK9 Antibody

Proprotein Convertase 9/PCSK9 Antibody

Proprotein Convertase 9/PCSK9 Antibody from R&D Systems, a Bio-Techne Brand

Specifications/Features

R&D Systems, a Bio-Techne Brand

Citations (23)

Reviews

Proprotein Convertase 9/PCSK9 Antibody from R&D Systems, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map