iScript™ gDNA Clear cDNA Synthesis Kit, 25 x 20 µl reactions 1725034 from Bio-Rad

Product Specs
ItemiScript™ gDNA Clear cDNA Synthesis Kit, 25 x 20 µl reactions
CompanyBio-Rad
Price $271.00Supplier Page View Company Product Page
Catalog Number1725034

Add to Compare List

Bio-Rad

Bio-Rad Laboratories, Inc. Life Science Research Group 2000 Alfred Nobel Drive

Hercules, California 94547

United States

Phone: 800-424 6723
800-879 2289

Company Profile

Website: http://discover.bio-rad.com

(1) The LDL pathway regulates actomyosin ring dynamics necessary for optimal cell wound repairMicroPubl BiolFebruary 6, 2026Geethika Burugupally, Mitsutoshi Nakamura, Cassandra Aarrestad, Susan M ParkhurstiTaq Universal SYBR Green Supermix,Bio-Rad,Cat#1725120 iScript™ gDNA Clear cDNA Synthesis Kit,Bio-Rad,Cat#1725034 PRIMER NAME,SEQUENCE (5' -> 3'),SEQUENCE (5' -> 3') RpL32-F,ATGCTAAGCTGTCGCACAAATG,ATGCTAAGCTGTCGCACAAATG RpL32-R,GTTCGATCCGTAACCGATGT,GTTCGATCCGTAACCGATGT Jeb-F,GGAGCGAGAGCGACTAATGC,GGAGCGAGAGCGACTAATGC Jeb-R,GACCGCGATGATTACTGCCC,GACCGCGATGATTACTGCCC LpR2-F,GAAATAGCCTTGCATGTGATTGC,GAAATAGCCTTGCATGTGATTGC LpR2-R,GTGGTAGACGGGATTCTCGAA,GTGGTAGACGGGATTCTCGAA

(2) Foxi1 regulates multipotent mucociliary progenitors and ionocyte specification through transcriptional and epigenetic mechanismsPLoS BiolJanuary 5, 2026Sarah Bowden, Magdalena Maria Brislinger-Engelhardt, Mona Hansen, Aisha Andricek, Africa Temporal-Plo, Damian Weber, Sandra Hägele, Fabian Lorenz, Tim Litwin, Clemens Kreutz, et al.iScript cDNA Synthesis Kit (Bio-Rad #1708891) (S5A Fig) or iScript gDNA clear cDNA Synthesis Kit (Bio-Rad #1725034) (S6B Fig). qPCR reactions were conducted using Sso Advanced Universal SYBR Green Supermix (Bio-Rad

(3) Targeted chelation therapy decreases NLRP3 expression by vascular cells and acts as senomorphic in chronic kidney disorder induced vascular calcificationInt J Immunopathol PharmacolDecember 16, 2025Shivani Arora, Gregory Halsey, Fatema Tuj Zohora, Alyssa Swiss, Narendra VyavahareSC98824), anti-rabbit IgG secondary antibody Cy5 (Invitrogen, A10523) cDNA synthesis Kit (Bio-Rad, Cat# 1725034), iTaq—Universal SYBR Green Super mix 12 reagent (Bio-Rad, Cat# 172512), SA-βGal Staining Kit (Cell Signaling

(4) DNA methylation of the endothelin receptor B makes blue fish yellowNature CommunicationsDecember 7, 2025Wei Fang, Danielle Blakkan, Alexandra Byrne, Gail Lee, Roya Bashier, Russell D. Fernald, Sebastian G. AlvaradoQiagen) with 1ug of RNA used for cDNA conversion and DNAse cleanup (iScript gDNA clear cDNA synthesis kit;1725034, Biorad) according to manufacturer’s guidelines. Primers were designed over exon boundaries and validated

(5) Intracellular fatty acid levels differentially impact target silencing by FDA-approved siRNA drugsBiochemical PharmacologyDecember 1, 2025Sherouk M. Tawfik, Le Tra Giang Giang Nguyen, Jing Jin, Xiao-bo ZhongLABTECH, Ortenberg, Germany). cDNA synthesis was then performed using a Revertaid cDNA synthesis kit (1725034, Bio-Rad, Carlsbad, CA, USA). 2.8. Quantification of Target mRNA Levels of siRNA Drugs by RT-qPCR RT-qPCR

(6) MERS-CoV and SARS-CoV-2 infection in diverse human lung organoid-derived culturesJournal of virologyOctober 23, 2025Chiok KL, Jenik K, Fenton M, Falzarano D, Dhar N, Banerjee A.generated with the iScript gDNA Clear cDNA Synthesis Kit following the manufacturer’s instructions (BioRad 1725034). cDNA was diluted 1:10 in RNAse free water and used as template for qPCRs using Ssoadvanced Universal

(7) Non-contact electrical stimulation via a Vector-potential transformer promotes bone healing in drill-hole injury modelJournal of Bone and Mineral MetabolismApril 29, 2025Nao Yashima, Wataru Minamizono, Hiroya Matsunaga, Jiazheng Lyu, Kaoru Fujikawa, Hirai Suito, Takumi Okunuki, Shingo Nakai, Masafumi OhsakoInvitrogen). Total RNA was reverse-transcribed into cDNA using an iScript™ gDNA Clear cDNA Synthesis Kit (1725034, Bio-Rad, Tokyo, Japan). The cDNA was mixed with various TaqMan probes and analyzed using qRT-PCR. TaqMan

(8) Senescent-like microglia limit remyelination through the senescence associated secretory phenotypeNature communicationsMarch 7, 2025Gross PS, Durán-Laforet V, Ho LT, Melchor GS, Zia S, Manavi Z, Barclay WE, Lee SH, Shults N, Selva S, et al.(Zymo Research #R2050) and reverse transcribed to cDNA using the iScript gDNA Clear cDNA Synthesis Kit (Biorad #1725034). RT-qPCR was performed with SsoAdvanced Universal SYBR Green Supermix (Biorad #1725271). Primers used

(9) Pumilio differentially binds to mRNA 3′ UTR isoforms to regulate localization of synaptic proteinsEMBO ReportsFebruary 21, 2025Dominika Grzejda, Anton Hess, Andrew Rezansoff, Sakshi Gorey, Judit Carrasco, Carlos Alfonso-Gonzalez, Stylianos Tsagkris, Lena Neuhaus, Mengjin Shi, Hasan Can Ozbulut, et al.Serum,Gibco,A5256701 Flag peptide,Sigma,F3290 Insulin,Sigma-Aldrich,I6634 iScript gDNA Clear cDNA Synthesis Kit,Bio-Rad,1725034 Laminin,VWR,47743-734 LDS sample buffer,FisherScientific,NP0007 Liberase DH,Roche,5401054001 Lexogen

(10) Astrocyte-induced Cdk5 expedites breast cancer brain metastasis by suppressing MHC-I expression to evade immune recognitionNature Cell BiologyOctober 1, 2024Arseniy E. Yuzhalin, Frank J. Lowery, Yohei Saito, Xiangliang Yuan, Jun Yao, Yimin Duan, Jingzhen Ding, Sunil Acharya, Chenyu Zhang, Abigail Fajardo, et al.RNeasy mini kit (74104, Qiagen) and reverse transcribed using an iScript gDNA clear cDNA synthesis kit (1725034, Bio-Rad). Quantitative PCR was conducted with use of iTaq Universal SYBR green supermix (1725121, Bio-Rad),

(11) Reversal of heavy arterial calcification in a rat model of chronic kidney disease using targeted ethylene diamine tetraacetic acid-loaded albumin nanoparticlesCardiovascular Diagnosis and TherapyAugust 31, 2024Fatema Tuj Zohora, Shivani Arora, Alyssa Swiss, Naren VyavaharecDNA synthesis was performed using 200 ng of total RNA with iScript gDNA clear cDNA synthesis Kit (Cat# 1725034, Bio-Rad, Laboratories, Inc., Hercules, CA, USA). The total cDNA obtained was diluted five times before

(12) Branched-chain amino acids and L-alanine supplementation ameliorate calcium dyshomeostasis in sarcopenia: New insights for nutritional interventionsFrontiers in PharmacologyJune 19, 2024Elena Conte, Paola Mantuano, Brigida Boccanegra, Paola Imbrici, Giorgia Dinoi, Roberta Lenti, Ornella Cappellari, Donato Cappetta, Antonella De Angelis, Liberato Berrino, et al.transcription was performed using an iScriptTM gDNA CLR cDNA kit (Bio-Rad, Hercules, CA, United States, cod.1725034). Real-time PCR was performed using the Bio-Rad CFX Connect instrument and custom pre-loaded PCR plates.

(13) CRISPRi screen of long non-coding RNAs identifies LINC03045 regulating glioblastoma invasionPLOS GeneticsJune 10, 2024Kathleen Tsung, Kristie Q. Liu, Jane S. Han, Krutika Deshpande, Tammy Doan, Yong-Hwee Eddie Loh, Li Ding, Wentao Yang, Josh Neman, Yali Dou, et al.cDNA synthesis were completed in the same tube with the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad, 1725034). qPCR was performed with the iTaq Universal SYBR Green Supermix (Bio-Rad, 1725121) on a Roche LightCycler 96 instrument

(14) Two Septin complexes mediate actin dynamics during cell wound repairCell ReportsMay 28, 2024Viktor Stjepić, Mitsutoshi Nakamura, Justin Hui, Susan M. ParkhurstiTaq Universal SYBR Green Supermix,Bio-Rad,Cat# 1725120 iScript™ gDNA Clear cDNA Synthesis Kit,Bio-Rad,Cat# 1725034 Na2ATP,Sigma-Aldrich,Cat# A2383 Methyl Cellulose,Sigma-Aldrich,Cat# M0512 Protocatechuate Acid (PCA),Sigma-Aldrich,Cat#

(15) Extracellular metallothionein as a therapeutic target in the early progression of type 1 diabetesCell Stress and ChaperonesApril 1, 2024Clare K. Melchiorre, Matthew D. Lynes, Sadikshya Bhandari, Sheng-Chiang Su, Christian M. Potts, Amy V. Thees, Carol E. Norris, Lucy Liaw, Yu-Hua Tseng, Michael A. Lyneson RNA isolated from cell pellets, using the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad Catalog #1725034) according to the manufacturer’s instructions. Real-time polymerase chain reaction (PCR) analysis Real-time PCR

(16) ChREBP is activated by reductive stress and mediates GCKR-associated metabolic traitsCell metabolismJanuary 2, 2024Singh C, Jin B, Shrestha N, Markhard AL, Panda A, Calvo SE, Deik A, Pan X, Zuckerman AL, Ben Saad A, et al.Fast Advanced Master Mix,Applied Biosystems,44-445-57 Iscript™ gDNA Clear cDNA Synthesis Kit,Bio-Rad,1725034 "Pyridine, for HPLC, ≥99.9%",Sigma Aldrich,270407-100ML "Ethanol, Absolute (200 Proof), Molecular Biology Grade

(17) Cytosolic nucleic acid sensors and interferon beta-1 activation drive radiation-induced anti-tumour immune effects in human pancreatic cancer cellsFrontiers in immunologyJanuary 1, 2024Kerschbaum-Gruber S, Kleinwächter A, Popova K, Kneringer A, Appel LM, Stasny K, Röhrer A, Dias AB, Benedum J, Walch L, et al.and subsequent cDNA synthesis was performed using iScript™ gDNA Clear cDNA Synthesis Kit (Bio-Rad, 1725034) according to the manufacturer’s instructions. IFNB1, CXCL10, IL-6 and TNF-α levels relative to TBP

(18) Single‐cell transcriptomics stratifies organoid models of metabolic dysfunction‐associated steatotic liver diseaseThe EMBO JournalDecember 11, 2023Anja Hess, Stefan D Gentile, Amel Ben Saad, Raza‐Ur Rahman, Tim Habboub, Daniel S Pratt, Alan C Mullen200 or 500 ng RNA were reverse‐transcribed using the iScript gDNA Clear cDNA Synthesis Kit (Biorad, 1725034), and no‐RT‐controls and mastermix controls were prepared. qPCR reactions were prepared from cDNA at

(19) Shiftless Is a Novel Member of the Ribosome Stress Surveillance Machinery That Has Evolved to Play a Role in Innate Immunity and Cancer SurveillanceVirusesNovember 23, 2023Jamie A. Kelly, Jonathan D. Dinmanmanufacturer’s protocol. cDNA synthesis was performed using the iScript gDNA Clear cDNA synthesis kit (BioRad 1725034) according to the manufacturer’s protocol using 500 ng total RNA. qPCR was performed with 100 ng of

(20) Two Septin Complexes Mediate Actin Dynamics During Cell Wound RepairbioRxivNovember 19, 2023Viktor Stjepić, Mitsutoshi Nakamura, Justin Hui, Susan M. ParkhurstiTaq Universal SYBR Green Supermix,Bio-Rad,Cat# 1725120 iScript™ gDNA Clear cDNA Synthesis Kit,Bio-Rad,Cat# 1725034 Na2ATP,Sigma-Aldrich,Cat# A2383 Methyl Cellulose,Sigma-Aldrich,Cat# M0512 Protocatechuate Acid (PCA),Sigma-Aldrich,Cat#

Be the First to Write a Review!

iScript™ gDNA Clear cDNA Synthesis Kit, 25 x 20 µl reactions

iScript™ gDNA Clear cDNA Synthesis Kit, 25 x 20 µl reactions from Bio-Rad

Description

Bio-Rad

Citations (42)

Reviews

iScript™ gDNA Clear cDNA Synthesis Kit, 25 x 20 µl reactions from Bio-Rad

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map