Genomic DNA Purification Kit K0512 from Thermo Fisher Scientific

Product Specs
ItemGenomic DNA Purification Kit
CompanyThermo Fisher Scientific
Price Inquire
Catalog NumberK0512
Quantity100 Preps
ApplicationsPCR, Southern blotting, sequencing, nucleic acid labeling, hybridization
Sample TypeWhole blood, serum, tissue samples
Assay Time25 min

Add to Compare List

Thermo Fisher Scientific

168 Third Avenue

Waltham, MA 02451

United States

Phone: 800-678-5599

Company Profile

Website: www.thermofisher.com

(1) Orderly mitosis shapes interphase genome architectureeLifeApril 21, 2026Krishnendu Guin, Adib Keikhosravi, Raj Chari, Gianluca Pegoraro, Tom Mistelisingle-cell clones was isolated using genomic DNA purification kit (Thermo Fisher Scientific, Cat. No. K0512) as recommended. To identify homozygously tagged dTAG-SPC24 clones, KG49 (5'AGCTCAGACTTACAGGCGTG3')

(2) Macrolide resistance trajectories across three Bordetella pertussis genetic backgrounds under stepwise erythromycin exposureFront MicrobiolApril 17, 2026Kaichong Jiang, Wei Wang, Wenjuan Zhao, Yang Luan, Da Xue, Shuyue Tang, Xiao Ma, Zengguo Wangpurified using the Bacterial DNA Kit (Omega, D3350) and Genomic DNA Purification Kit (Thermo Fisher, K0512) according to the manufacturer’s protocol. The gene sequences were determined using the ABI 3730XL instrument.

(3) Structural transformation of a hydrogel-forming cell division protein ZapB of multidrug resistant Klebsiella pneumoniae with small moleculesPLoS OneApril 10, 2026Ayesha Khan, M. Iqbal Choudhary, Sumaira Javaid, Humaira Zafar, Innokentiy Maslennikov, Atia-Tul Wahabpurified by using genomic DNA extraction kit, following the manufacturer’s protocol (Thermo Scientific, K0512, USA). Based on the sequence of zapB gene, two primers, 5’- CCG GCC GGC ATG TCA TTA GAA GT-3’ (forward),

(4) Genome of an Escherichia coli engineered for improved control over polyhydroxyalkanoate monomer compositionMicrobiology Resource AnnouncementsApril 9, 2026Robert E. Mejia, Patricia Q. Tran, Deepak Kumar, Brian G. Fox, Erica L-W. MajumderGenomic DNA was subsequently purified using the Genomic DNA Purification Kit (Thermo Scientific cat. K0512). Sequencing libraries were prepared and sequenced by SeqCenter (Pittsburgh, PA, USA). Library preparation

(5) The Disruption of the HIV-1 Gag Start Codon via Editing Using MmCas12m-Dual Base Editor-Loaded Virus-like ParticlesCurrent Issues in Molecular BiologyFebruary 25, 2026Timur Aliev, Almaz Imatdinov, Elena Prudnikova, Oleg Taranov, Ksenia Emtsova, Ilnaz Imatdinov, Alexander Agafonovby T7EI Assay The genomic DNA of TZM-bl cells was extracted using a genomic DNA purification kit (#K0512, Thermo Fisher Scientific) according to the manufacturer’s protocol. Q5 High-Fidelity DNA Polymerase

(6) Effect of EGR1/LIPT1 regulatory axis on cuproptosis in chromophobe renal cell carcinomaBriefings in Functional GenomicsJanuary 9, 2026Jingxian Luo, Mingqiang Su, Xianyong Li, Dayong Ye, Xiaofu Zeng, Yujie Wang, Guangqing Fuwere boiled and uncrosslinked, and then the purified DNA was collected using a DNA purification kit (K0512, Invitrogen, USA). Anti-IgG (Abcam, ab216352, UK) was used as a negative control in the experiment.

(7) Detection of Methicillin-resistant Staphylococcus aureus (MRSA) and biofilm formation among dental patients and dental health care workers: cross sectional studyClin Oral InvestigJanuary 3, 2026Manal M. Darwish, Nashwa Naguib Omar, Rania Farouk, Kawther Ibrahim, Rasha Attia, Lamiaa M. EL-MousselyDNA samples were extracted using the Thermo Scientific Genomic DNA Purification Kit (Catalog number K0512). The primers for amplifying the icaA and icaD genes were obtained from Invitrogen Fisher Scientific

(8) RNA sequencing enables neoantigen discovery and vaccine validation in breast and lung cancerFront ImmunolOctober 8, 2025Hongye Hu, Yicheng Xiong, Danhong Lu, Weihong Sun, Xiaoping Su, Danni Mo, Lu Chen, Guan Wang, Jiayan Wang, Xiaohua Zhang, et al.tumor sample were extracted in triplicate with the aid of the DNA extraction agent (Thermo Scientific™, K0512, Shanghai, China). Using 2μg of total RNA, barcoded mRNA-seq cDNA libraries were constructed with Illumina

(9) Mitotic DNA repair by TMEJ suppresses replication stress-induced nuclear envelope reassembly defectNat CommunOctober 3, 2025Guojun Ye, Yide He, Yihui Zhang, Dongchen Li, Fuhai Liu, Yi Li, Qinglian Ge, Qiong Guo, Shuya Han, Chunyu Song, et al.expanded clones was extracted using a Genomic DNA purification Kit (Thermo Fisher Scientific, Cat. #K0512) for PCR. PCR products were run on an agarose gel and purified using PCR gel purification kit (Thermo Fisher Scientific

(10) The DEC2‐SCN2A Axis is Essential for the Anticonvulsant Effects of Cannabidiol by Modulating Neuronal PlasticityAdvanced ScienceSeptember 1, 2025Huifang Song, Yifan Wang, Lili Wang, Chang Guo, Shiqi Liu, Yi Rong, Jiawen Tian, Chao Peng, Yuying Shao, Zhixiong Ma, et al.Luciferase Constructs Mouse genomic DNA was extracted using a purification kit (ThermoFisher Scientific, K0512), and then used as a template for PCR amplification. The 1.5 kb fragment of the Scn2a promoter region

(11) KSHV reprograms host RNA splicing via FAM50A to activate STAT3 and drive oncogenic cellular transformationmBioJuly 9, 2025Shenyu Sun, Ling Ding, Karla Paniagua, Xian Wang, Yufei Huang, Mario A. Flores, Shou-Jiang Gao(sgFAM50A-1, 2, and 3) were collected and extracted by the Total DNA Isolation Kit (ThermoFisher Scientific, K0512). KSHV DNA was measured using SsoAdvanced Universal SYBR Green Supermix (BioRad, 172-5272) based qPCR

(12) Association of Nrf2 Single Nucleotide Polymorphism rs35652124 and FABP4 Levels with Peripheral Artery Disease Among Type 2 Diabetes Mellitus Pakistani PopulationCurr Issues Mol BiolJuly 9, 2025Iqra Ayaz, Nakhshab Choudhry, Amna Ihsan, Tehreem Zubair, Aamir Jamal Gondal, Nighat YasminDNA was isolated from blood using the GeneJET Whole Blood Genomic DNA Purification Kit (catalogue # K0512, Thermo Fischer Scientific). Nrf2 SNP rs35652124 was analyzed by restriction fragment length polymorphism.

(13) CD4 + T Cells Expressing Viral Proteins Induce HIV-Associated Endothelial Dysfunction and Hypertension Through Interleukin 1α–Mediated Increases in Endothelial NADPH Oxidase 1CirculationApril 22, 2025Taylor C. Kress, Candee T. Barris, Laszlo Kovacs, Beryl N. Khakina, Coleton R. Jordan, Thiago Bruder-Nascimento, David W. Stepp, Rodger MacArthur, Vijay S. Patel, Jie Chen, et al.washed with PBS, submitted to genomic DNA isolation (Genomic DNA Purification Kit, Thermo Fisher, CAT: K0512) and 8-OHdg quantification via ELISA (abcam, CAT: ab201734). FACS staining, acquisition and analysis. Single-cell

(14) Protocol for the purification of the plastid-encoded RNA polymerase from transplastomic tobacco plantsSTAR ProtocJanuary 11, 2025Xiao-Xian Wu, Fan Li, Chuxia Zhu, Shu-Yi Sun, Wen-Hui Mu, Stephanie Ruf, Ralph Bock, Yu Zhang, Fei ZhouGeneJet gel extraction and DNA cleanup micro kit,Thermo Scientific,Cat #K0832 Genomic DNA purification kit,Thermo Scientific,Cat #K0512 Qiagen plasmid midi kit,QIAGEN,Cat #12143 Universal DNA purification kit,Tiangen,Cat #DP214-02 ,, Experimental models

(15) PLD3 and PLD4 synthesize S,S-BMP, a key phospholipid enabling lipid degradation in lysosomesCellNovember 27, 2024Shubham Singh, Ulrich E. Dransfeld, Yohannes A. Ambaw, Joshua Lopez-Scarim, Robert V. Farese, Tobias C. Waltherdescribed. Isolated lysosomes were processed through a genomic DNA extraction kit (ThermoFisher Scientific #K0512) and nucleic acids were eluted in 100 μL water. Isolated DNA was PCR amplified for 60 cycles in technical

(16) The links between neuroinflammation, brain structure and depressive disorder: A cross-sectional study protocolPLOS ONENovember 20, 2024Egle Milasauskiene, Julius Burkauskas, Simonas Jesmanas, Rymante Gleizniene, Vilmante Borutaite, Kristina Skemiene, Paulina Vaitkiene, Virginija Adomaitiene, Saulius Lukosevicius, Brigita Gradauskiene, et al.from peripheral blood leucocytes will be extracted using a genomic DNA purification kit (Catalog No. K0512; Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s recommendations. Several

(17) Morphine induces inflammatory responses via both TLR4 and cGAS-STING signaling pathwaysCytokineNovember 1, 2024Xie F, Kitagawa Y, Ogata H, Yasuhara S, You Z, Jeevendra Martyn JA.at 10,000 × g for 15 minutes to collect the cytoplasmic fraction. The genomic DNA purification kit (K0512, Thermo Scientific, USA) was used to isolate the DNA from the collected cytoplasm supernatant of BV2

(18) Potential protective association of the AA genotype and a allele of CXCR4 rs2228014 polymorphism with COVID-19 severity in adult egyptiansBMC Infectious DiseasesOctober 15, 2024Osama H. Korayem, Amr E. Ahmed, Mohamed H. Meabed, Doaa M. Magdy, Wafaa M. Abdelghanyfor DNA isolation from the blood of COVID-19 patients according to the main protocol. Catalog number: K0512. Genotyping of CXCR4 rs2228014 The master mix used for DNA amplification was Genotyping TaqPath 1-Step

(19) Tumor-associated macrophage-derived itaconic acid contributes to nasopharyngeal carcinoma progression by promoting immune escape via TET2Cell communication and signaling : CCSAugust 27, 2024Zhang X, Qian S, Wu P, Yu B, Yin D, Peng X, Li S, Xiao Z, Xie Z.collected cells were subjected to genomic DNA extraction by a genomic DNA purification kit (Catalog No. K0512, Thermo). The extracted DNA (1 µg) was mixed with 6 × SSC (200 µL), followed by denaturation at 100

(20) Association of monoaminergic gene polymorphisms in chronic inflammatory pulmonary disease patients with successful smoking cessationBMC Pulmonary MedicineAugust 26, 2024Angela Mikaczo, Csaba Papp, Tamas Erdei, Aniko Posa, Gabor Zahuczky, Csaba Varga, Janos Szabo, Rudolf Gesztelyi, Maria Szilasi, Judit Zsugaspecimens according to standard protocols using the Genomic DNA Purification Kit (Thermo Fisher Scientific #K0512). The quality and integrity of DNA were evaluated by agarose gel electrophoresis and UV-spectrometry.

Be the First to Write a Review!

Genomic DNA Purification Kit from Thermo Fisher Scientific

Description

Thermo Fisher Scientific

Citations (89)

Reviews

Genomic DNA Purification Kit from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map