Multiplex CRISPR/Cas9 Assembly System Kit 1000000055 from Addgene Inc.

Product Specs
ItemMultiplex CRISPR/Cas9 Assembly System Kit
CompanyAddgene Inc.
Price Supplier Page View Company Product Page
Catalog Number1000000055
Quantity1
ApplicationsCRISPR
Nucleic Acid TypeGene-specific Knockout Kits
Vector Type (Standardized)Plasmid

Add to Compare List

Addgene Inc.

490 Arsenal Way

Suite 100

Watertown, Massachusetts 02472

United States

Phone: +1 (617) 233-4363

Email: help@addgene.org

Company Profile

Website: www.addgene.org/

(1) Functional landscape of mechanistic diversity in 27 claudin family members at tight junctionsSci AdvOctober 31, 2025Hiroka Kashihara, Hiroo Tanaka, Manabu Kitamata, Gen Shiratsuchi, Tatsuya Katsuno, Kazuto Tsukita, Tomoki Nishida, Mayumi Hamasaki, Fabian Eisenstein, Hiroshi Suzuki, et al.constructed using the Multiplex CRISPR/Cas9 Assembly System Kit (Addgene, Watertown, MA, USA; catalog no. 1000000055): Vector 1 contained six gRNA expression cassettes targeting Cldn3, 4, 7, 9, 12, and 25 genes, while

(2) Therapeutic pCRISPRi Delivery to Lung Squamous Cell Carcinoma by Combining Nanobubbles and UltrasoundPharmaceuticsAugust 13, 2025Taiki Yamaguchi, Yoko Endo-Takahashi, Takumi Amano, Arina Ihara, Tetsushi Sakuma, Takashi Yamamoto, Takuya Fukazawa, Yoichi Negishi(pCRISPRi)ΔNp63A/B and pCRISPRiSOX2A/B were constructed using a Multiplex CRISPR/Cas9 Assembly Kit (#1000000055) and dCas9 Accessory Pack (#1000000062) from Addgene (Cambridge, MA, USA), respectively, as previously

(3) A human model to deconvolve genotype-phenotype causations in lung squamous cell carcinomaNat CommunApril 4, 2025Julia Ogden, Robert Sellers, Sudhakar Sahoo, Anthony Oojageer, Anshuman Chaturvedi, Caroline Dive, Carlos Lopez-GarciaSanger sequencing. The one-step multiplex CRISPR-Cas9 assembly system kit was a gift from Takashi Yamamoto (Addgene Kit #1000000055)44 was used to construct multiplex CRISPR-Cas9 plasmids used for the generation of cells harbouring

(4) Systematic dissection of sequence features affecting binding specificity of a pioneer factor reveals binding synergy between FOXA1 and AP-1Molecular CellAugust 8, 2024Cheng Xu, Holly Kleinschmidt, Jianyu Yang, Erik M. Leith, Jenna Johnson, Song Tan, Shaun Mahony, Lu Baithese two gRNA sequences were cloned into pGEP179_pX330K (Addgene 137882) and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions. These gRNA-containing vectors were assembled by Gibson assembly

(5) REMOVER-PITCh: microhomology-assisted long-range gene replacement with highly multiplexed CRISPR-Cas9In Vitro Cellular & Developmental Biology - AnimalAugust 1, 2024Shu Matsuzaki, Tetsushi Sakuma, Takashi YamamotoCRISPR vectors for each locus were constructed using the Multiplex CRISPR/Cas9 Assembly System Kit (no. 1000000055, Addgene) (Sakuma et al. 2014). Briefly, oligonucleotides for sgRNA were synthesized and annealed, and

(6) Rapid in vivo evaluation system for cholestasis-related genes in mice with humanized bile acid profilesHepatol CommunMarch 22, 2024Kihiro Wakasa, Ryutaro Tamura, Shuhei Osaka, Hajime Takei, Akihiro Asai, Hiroshi Nittono, Hiroyuki Kusuhara, Hisamitsu Hayashisequence pair was annealed to an oligonucleotide as follows: cloned into pX330A or pX330S plasmid (#1000000055; Addgene, Cambridge, MA),17 assembled into one segment through golden gate reaction, and subcloned to

(7) Differential N-terminal processing of beta and gamma actiniScienceOctober 21, 2022Li Chen, Pavan Vedula, Hsin Yao Tang, Dawei W. Dong, Anna S. Kashinaacid,"Sigma, USA",Cat#: 302031-100ML Multiplex CRISPR/Cas9 Assembly System Kit,"Addgene, USA",Cat#: 1000000055 MaxQuant 1.6.17.0,Max-Planck Institute for Biochemistry,https://www.maxquant.org/ Xcalibur software,"Thermo

(8) Bioorthogonal Chemical Epigenetic Modifiers Enable Dose-Dependent CRISPR Targeted Gene Activation in Mammalian CellsACS synthetic biologyApril 15, 2022Lu D, Foley CA, Birla SV, Hepperla AJ, Simon JM, James LI, Hathaway NA.Addgene plasmid 61427. The multiplexed MS2 stem-loop-containing gRNAs were modified from Addgene kit 1000000055 to be expressed in lentiviral backbone and remove the Cas9 protein.28 Specific gRNA sequences for each

(9) The FASTK family proteins fine-tune mitochondrial RNA processingPLoS geneticsNovember 1, 2021Ohkubo A, Van Haute L, Rudler DL, Stentenbach M, Steiner FA, Rackham O, Minczuk M, Filipovska A, Martinou JC.knockout cells To generate FASTKDs-KO cells, we used Multiplex CRISPR/Cas9 Assembly Systems (Addgene Kit #1000000055) [54]. A single gRNA was cloned into pX330A or pX330S, and three gRNAs (FASTKD3, FASTKD4, and FASTKD5)

(10) Interdependent Impact of Lipoprotein Receptors and Lipid-Lowering Drugs on HCV InfectivityCellsJune 29, 2021Zapatero-Belinchón FJ, Ötjengerdes R, Sheldon J, Schulte B, Carriquí-Madroñal B, Brogden G, Arroyo-Fernández LM, Vondran FWR, Maasoumy B, von Hahn T, et al.CRISPR/Cas9 single and double knock-out (KO) vectors was a gift from Takashi Yamamoto (Addgene kit # 1000000055) [46]. Target sequence oligonucleotides TTTGGAGTCAACCCAGTAG and TCATGAAGGCACGTTCGCCG against LDLR exon

(11) Promoter-proximal CTCF binding promotes distal enhancer-dependent gene activationNature structural & molecular biologyFebruary 1, 2021Kubo N, Ishii H, Xiong X, Bianco S, Meitinger F, Hu R, Hocker JD, Conte M, Gorkin D, Yu M, et al.assembled using the Multiplex CRISPR/Cas9 Assembly System kit (a gift from Takashi Yamamoto, Addgene kit #1000000055). Oligonucleotides for three gRNA templates were synthesized, annealed and introduced into the corresponding

(12) Breast cancer mammospheres secrete Adrenomedullin to induce lipolysis and browning of adjacent adipocytesBMC CancerDecember 1, 2020Martin Paré et al.used for constructing multiplex CRISPR/Cas9 vectors was a gift from Takashi Yamamoto (Addgene kit # 1000000055) [43]. The CRISPR/Cas 9 procedure induced a 584 base pairs deletion in the genomic DNA accompanied by

(13) Molecular dysregulation of ciliary polycystin-2 channels caused by variants in the TOP domainProceedings of the National Academy of SciencesMay 12, 2020Thuy N. Vien, Jinliang Wang, Leo C. T. Ng, Erhu Cao, Paul G. DeCaengenerate the HEK PKD2Null cell lines, we used a CRISPR-Cas9 gene editing kit available from Addgene (kit 1000000055). HEK 293 cells were electrotransfected with single-guide RNAs (caccgAGACACCCCCGTGTCCAAAA and

(14) A multiplexed gRNA piggyBac transposon system facilitates efficient induction of CRISPRi and CRISPRa in human pluripotent stem cellsScientific reportsJanuary 20, 2020Hazelbaker DZ, Beccard A, Angelini G, Mazzucato P, Messana A, Lam D, Eggan K, Barrett LE.pX330S-3 and a third vector pGEP179_pX330K (this study) according to kit instructions33 (Addgene Kit#1000000055). The pGEP179_pX330K plasmid is a modified entry vector generated by cloning the BsaI-pU6-sgRNA-BsaI

(15) Dose-dependent activation of gene expression is achieved using CRISPR and small molecules that recruit endogenous chromatin machineryNature biotechnologyJanuary 1, 2020Chiarella AM, Butler KV, Gryder BE, Lu D, Wang TA, Yu X, Pomella S, Khan J, Jin J, Hathaway NA.used plasmid Addgene # 61427. For the multiplexed gRNAs, constructs were modified from Addgene Kit # 1000000055 in order to express gRNAs in a lenti-viral backbone, containing ms2-compatible stem loops, and lacking

(16) Cell-based HTS identifies a chemical chaperone for preventing ER protein aggregation and proteotoxicityeLifeDecember 17, 2019Kitakaze K, Taniuchi S, Kawano E, Hamada Y, Miyake M, Oyadomari M, Kojima H, Kosako H, Kuribara T, Yoshida S, et al.assembled by Golden Gate cloning with the Multiplex CRISPR/Cas9 Assembly System Kit (Addgene Kit # 1000000055, MA, USA). 10X ERSE2-10X UPRE-5X AARE (EUA), 25X ERSE2, 25X UPRE, 25X AARE and 5X HSE-EGFP reporter

(17) Biased genome editing using the local accumulation of DSB repair molecules systemNature CommunicationsDecember 1, 2018Shota Nakade, Keiji Mochida, Atsushi Kunii, Kazuki Nakamae, Tomomi Aida, Kohichi Tanaka, Naoaki Sakamoto, Tetsushi Sakuma, Takashi Yamamotosingle or multiple sgRNAs were constructed using the Multiplex CRISPR/Cas9 Assembly System Kit (Kit #1000000055, Addgene)20 with some modifications. Briefly, oligonucleotides for sgRNA templates were synthesized,

(18) Development of an integrated CRISPRi targeting ΔNp63 for treatment of squamous cell carcinomaOncotargetJune 26, 2018Masakazu Yoshida, Etsuko Yokota, Tetsushi Sakuma, Tomoki Yamatsuji, Nagio Takigawa, Toshikazu Ushijima, Takashi Yamamoto, Takuya Fukazawa, Yoshio Naomotowere constructed using a Multiplex CRISPR/Cas9 Assembly System Kit (Addgene, Cambridge, MA, USA; Kit #1000000055) and a Multiplex CRISPR dCas9/FokI-dCas9 Accessory Pack (Addgene, Kit # 1000000062) as previously described

(19) Application of CRISPR/Cas9 Gene Editing System on MDV-1 Genome for the Study of Gene FunctionVirusesMay 24, 2018Yaoyao Zhang, Na Tang, Yashar Sadigh, Susan Baigent, Zhiqiang Shen, Venugopal Nair, Yongxiu Yao(http://crispr.mit.edu/) and cloned sequentially into the CRISPR/Cas9 vector pX330A-1x2 (Addgene, #1000000055), which co-expressed two gRNAs and Cas9 nuclease to generate a pp38-gNC construct. The primers used

(20) A Scalable Epitope Tagging Approach for High Throughput ChIP-Seq AnalysisACS Synthetic BiologyJune 16, 2017Xiong Xiong, Yanxiao Zhang, Jian Yan, Surbhi Jain, Sora Chee, Bing Ren, Huimin ZhaoPlasmids The CRISPRexp plasmid was assembled using the Multiplex CRISPR/Cas9 Assembly System kit (Addgene; Kit 1000000055). Three gRNA-expressing cassettes were incorporated into a single plasmid using Golden Gate assembly.21

Be the First to Write a Review!

Multiplex CRISPR/Cas9 Assembly System Kit

Multiplex CRISPR/Cas9 Assembly System Kit from Addgene Inc.

Description

Addgene Inc.

Citations (24)

Reviews

Multiplex CRISPR/Cas9 Assembly System Kit from Addgene Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map