pEX-N-His-GST Bacterial Expression Vector from OriGene Technologies

Product Specs
ItempEX-N-His-GST Bacterial Expression Vector
CompanyOriGene Technologies
Price $670.00Supplier Page View Company Product Page
Catalog NumberPS100028
Quantity10 µg
TypeBacterial Expression Vectors
Conjugate/Tag/Label (standardized)His tag
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Bacterial
Selectable MarkerAmpicillin (100 ug/mL)
Conjugate/Tag/LabelHis-GST

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) α-Mangostin Promotes In Vitro and In Vivo Degradation of Androgen Receptor and AR-V7 Splice Variant in Prostate Cancer CellsCancersApril 1, 2023Nauman MC, Won JH, Petiwala SM, Vemu B, Lee H, Sverdlov M, Johnson JJ.Protein Purification All plasmids were shuttled into the bacterial expression vector pEX-N-His-GST (PS100028, Origene) using T4 DNA Ligase (New England Biolabs) and AsiSI and MluI-HF restriction enzymes (New England

(2) Novel tau fragments in cerebrospinal fluid: relation to tangle pathology and cognitive decline in Alzheimer's diseaseActa neuropathologicaFebruary 1, 2019Cicognola C, Brinkmalm G, Wahlgren J, Portelius E, Gobom J, Cullen NC, Hansson O, Parnetti L, Constantinescu R, Wildsmith K, et al.PCR fragments were purified and cloned into Sgf I/Not I digested pEX_N_His_GST expression plasmid (PS100028, OriGene Technologies). 5′ primer sequence was TTCTAAGCGATCGCCATGGCTGAGCCCC, 3′ primer sequence for

(3) Single particle fluorescence burst analysis of epsin induced membrane fissionPloS oneJanuary 1, 2015Brooks A, Shoup D, Kustigian L, Puchalla J, Carr CM, Rye HS.

(4) Anthrax lethal factor cleavage of Nlrp1 is required for activation of the inflammasomePLoS pathogensJanuary 1, 2012Levinsohn JL, Newman ZL, Hellmich KA, Fattah R, Getz MA, Liu S, Sastalla I, Leppla SH, Moayeri M.µg/ml PA and 1 µg/ml LF). 6His-GST-fused rNlrp1 proteins were expressed in plasmid pEX-N-His-GST (cat# PS100028, Origene, Rockville, MD) and purified on glutathione-Sepharose columns by standard methods. High affinity

Be the First to Write a Review!