eBlocks™ Gene Fragments from Integrated DNA Technologies

Product Specs
ItemeBlocks™ Gene Fragments
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Numbereblock
ApplicationsDrug Discovery & Development
TypeCloning Vectors

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) A family portrait of lanmodulin selectivity for enhanced rare-earth separationsNature Chemical BiologyMarch 18, 2026Patrick Diep, Cody S. Madsen, Wonseok Choi, Ziye Dong, Christina S. Kang-Yun, Patricia F. V. Uychoco, Jeremy A. Seidel, Samuel A. Eaton, Yongqin Jiao, Joseph A. Cotruvo, et al.Mex-LanM, for cloning the full library. Inserts encoding LanM orthologs were synthesized in 96-well eBlock format as provided by Integrated DNA Technologies. Specifically, each well of the eBlock contained linear

(2) Impact of Heterogeneous DNA Methylation on the Accuracy of Quantitative Methylation-Specific PCR for Detecting DNA Hypermethylation in Prostate CancerInternational Journal of Molecular SciencesFebruary 27, 2026Wieke C. H. Visser, Hans de Jong, Laureen B. Janssen, Jolly Shrivastava, Peter F. A. Mulders, Jack A. Schalken, Willem J. G. Melchersproof-of-principle study, larger validation of this concept is required. 4. Materials and Methods 4.1. Design of eBLOCK with Known Variation in Methylation Synthetic double-stranded DNA fragments simulating varying DNA methylation

(3) Enhancing CAR-T cell activity prediction via fine-tuning protein language models with generated CAR sequencesBMC BioinformaticsFebruary 25, 2026Kei Yoshida, Shoji Hisada, Ryoichi Takase, Atsushi Okuma, Yoshihito Ishida, Taketo Kawara, Takuya Miura-Yamashita, Daisuke ItoBiotec, Gladbach, Germany), and 10 ng/mL human IL-15 (Miltenyi Biotec). Transduction Double strand DNA (eBlocks Gene Fragments, Integrated DNA Technologies, Coralville, IA, USA) encoding CAR mutant sequences were inserted into

(4) Identification of a potent V3 glycan site broadly neutralizing antibody targeting an N332gp120 glycan-independent epitopeNature ImmunologyFebruary 3, 2026Lutz Gieselmann, Andrew T. DeLaitsch, Malena Rohde, Caelan Radford, Johanna Worczinski, Anna Ashurov, Elvin Ahmadov, Judith A. Burger, Colin Havenar-Daughton, Sharvari Deshpande, et al.production of monoclonal antibodies The heavy and light chain V gene regions of mAbs were synthesized as eBlocks gene fragments (IDT), incorporating complementary overhangs pre-configured for cloning into expression vectors (IgG1,

(5) Large-scale mining of plant genomes unlocks the diversity of oxidosqualene cyclasesNature Chemical BiologyFebruary 1, 2026Michael J. Stephenson, Charlotte Owen, James Reed, Anne Osbournsequence (TACCCAGCTTTCTTGTACAAAGTGGTCCCC) were synthesized as double-stranded linear gene fragments (eBlocks gene fragments service, Integrated DNA Technologies). OSC9 mutants: The amino acid sequence of each mutant was used

(6) Glycan masking in immunogen design: computational and experimental methodsFrontiers in ImmunologyJanuary 7, 2026Gustavo Araiza, Josuel Morel, Minh H. Tran, Shan Jiang, Sean Murray, Emika Miyamoto, Hannah Vogts, Kyle L. Brown, Jens Meiler, Cristina E. Martinanumber of genes can be costly. Several high-throughput commercial gene synthesis services (such as IDT eBlock or Twist BioScience) offer custom DNA synthesis at roughly $0.06-$0.07 per base. These costs rapidly

(7) Computational design of dynamic biosensors for emerging synthetic opioidsNature CommunicationsJanuary 7, 2026Alison C. Leonard, Chase Lenert-Mondou, Rachel Chayer, Samuel Swift, Zachary T. Baumer, Ryan Delaney, Anika J. Friedman, Nicholas R. Robertson, Norman Seder, Jordan Wells, et al.bioluminescence resonance energy transfer (BRET) between the pair43. This protein sequence was ordered as an eBlock from IDT (Supplementary Table 11) and cloned into a protein expression backbone from pJS723 using Gibson

(8) Designing novel solenoid proteins with in silico evolutionCommunications ChemistryDecember 4, 2025Daniella Pretorius, Georgi I. Nikov, Kono Washio, Steve-William Florent, Henry N. Taunt, Sergey Ovchinnikov, James W. Murrayfragments encoding the designed protein coding sequences (CDSs) were ordered as a 96-well formatted eBlock from Integrated DNA Technologies. Each sequence was designed with inwards facing flanking SapI restriction

(9) Multimodal diffusion for joint design of protein sequence and structureProtein ScienceDecember 1, 2025Shaowen Zhu, Siddhant Gulati, Yuxuan Liu, Siddhi Kotnis, Qing Sun, Yang ShenTechnologies (IDT) Codon Optimization tool, and gene fragments for GFP variants were obtained from IDT (eBlocks Gene Fragments). The plasmid backbone and gene fragments were amplified using Phusion High‐Fidelity DNA Polymerase

(10) A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter systemJournal of VirologyNovember 25, 2025Liren Sun, Andrew Snedeker, Liudi Tangplasmid backbone, which was assembled with different 147-nt synthesized sensor fragments (Table S2, IDT eBlock). Similarly, HBV-RADARS-131 to -151 were designed to screen for the optimal sensor length, using the

(11) Smed-pou4-2 regulates mechanosensory neuron regeneration and function in planarianseLifeNovember 18, 2025Ryan A McCubbin, Mohammad A Auwal, Shengzhou Wang, Sarai Alvarez Zepeda, Roman Sasik, Robert W Zeller, Kelly G Ross, Ricardo M Zayas2013) or pJC53.2 (Collins et al., 2010) vectors through ligation-independent cloning. Primer sequences, eBlock sequences, and EST clone accession numbers are listed in Supplementary file 5. In situ hybridization Riboprobes

(12) From sequence to scaffold: Computational design of protein nanoparticle vaccines from AlphaFold2-predicted building blocksProceedings of the National Academy of SciencesNovember 11, 2025Cyrus M. Haas, Naveen Jasti, Annie Dosey, Joel D. Allen, Rebecca Gillespie, Jackson McGowan, Elizabeth M. Leaf, Max Crispin, Cole A. DeForest, Masaru Kanekiyo, et al.for construct generation. Bacterial Protein Expression and Purification. To screen initial designs, eBlocks gene fragments (Integrated DNA Technologies) were cloned into a pET29b+-based vector backbone via Golden Gate Assembly

(13) Stage-specific roles of clonally expanded CD8+ T cells in regulating amyloid pathology in Alzheimer's disease modelsNat CommunOctober 27, 2025Masaki Ohyagi, Minako Ito, Mana Iizuka-Koga, Setsuko Mise-Omata, Akihiko Yoshimurawere obtained from scTCR-seq data from the brains of WT and AppNL-G-F mice. The DNA was synthesized by eBlocks Gene Fragments (Integrated DNA Technologies). The α and β chains were linked by the P2A sequence and inserted into

(14) High-resolution spatial mapping of cell state and lineage dynamics in vivo with PEtracerScienceOctober 16, 2025Luke W. Koblan, Kathryn E. Yost, Pu Zheng, William N. Colgan, Matthew G. Jones, Dian Yang, Arhan Kumar, Jaspreet Sandhu, Alexandra Schnell, Dawei Sun, et al.manufacturer’s protocol. Digested backbone gel extracted as described above from a 1% agarose gel. eBlock fragments were ordered from IDT or Twist Bioscience encoding the relevant pegRNA or epegRNA sequences

(15) Comprehensive Mapping of Functional Enhancers in Chinese Hamster Ovary CellsBiotechnology and BioengineeringOctober 3, 2025María Santos, Yusuf B. Johari, Laura Biggins, Natalie C. Elliott, Stefan Schoenfelder, Mounika Boddireddy, Daniel K. Fabian, Michael Anbar, Peter M. O'Callaghan, Peter J. Rugg‐Gunnharvested at 6 h versus 24 h posttransfection. For this experiment, we included 76 synthetic sequences (eBlocks Gene Fragments, IDT; Supporting Information Table S2). These sequences comprised 56 putative enhancers based on chromatin‐state,

(16) Parametrically guided design of beta barrels and transmembrane nanopores using deep learningProceedings of the National Academy of SciencesSeptember 23, 2025David E. Kim, Joseph L. Watson, David Juergens, Sagardip Majumder, Ria Sonigra, Stacey R. Gerben, Alex Kang, Asim K. Bera, Xinting Li, David Bakerdetecting these hydrogen bonds. Protein Expression and Purification. RFjoint2 designs were synthesized as eBlock gene fragments by Integrated DNA Technologies, and cloned into the pET29b+ vector using Golden Gate

(17) Identification of a broad and potent V3 glycan site bNAb targeting an N332 gp120 glycan-independent epitopebioRxivSeptember 16, 2025Lutz Gieselmann, Andrew T. DeLaitsch, Malena Rohde, Caelan Radford, Johanna Worczinski, Anna Momot, Elvin Ahmadov, Judith A. Burger, Colin Havenar-Daughton, Sharvari Deshpande, et al.production of monoclonal antibodies The heavy and light chain V gene regions of mAbs were synthesized as eBlocks gene fragments (IDT), incorporating complementary overhangs pre-configured for cloning into expression vectors (IgG1,

(18) A combinatorial mutational map of active non-native protein kinases by deep learning guided sequence designbioRxivAugust 3, 2025Kosuke Seki, Amy B. Guo, Deniz Akpinaroglu, Tanja Kortemmepr82 and assembled with a linearized Sol50–0.3–89 gene made by PCR using primers pr83 and pr84 from an eBlock (IDT). To clone variants with a redesigned fragment (Table S2), a pET backbone was linearized by PCR

(19) A map of enhancer regions in primary human neural progenitor cells using capture STARR-seqGenome ResearchAugust 1, 2025Sophia C. Gaynor-Gillett, Lijun Cheng, Manman Shi, Jason Liu, Gaoyuan Wang, Megan Spector, Qiuyu Guo, Le Qi, Mary Flaherty, Martha Wall, et al.to be mutated according to the alternate allele present in the eQTL. For each enhancer, we created eBlock (IDT) gene fragments with (alternate) and without (reference) the eQTL. Of our candidate regions, seven

(20) U-rich elements drive pervasive cryptic splicing in 3' UTR massively parallel reporter assaysNat CommunJuly 25, 2025Khoa Dao, Courtney F. Jungers, Sergej Djuranovic, Anthony M. Mustoeadaptors matching the final assembled inserts in Griesemer were ordered as eBlocks (IDT) (Table S2). Each eBlock was amplified by PCR using the Griesemer_Amp_F and Griesemer_Amp_R primers (Table S1) and then cloned

Be the First to Write a Review!

eBlocks™ Gene Fragments from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (41)

Reviews

eBlocks™ Gene Fragments from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map