NextSeq 550 System from Illumina

Product Specs
ItemNextSeq 550 System
CompanyIllumina
Price Inquire
Catalog NumberNextSeq 550
Read Length1 × 75 bp, 2 x 75 bp, 2 x 150 bp
Maximum Reads400 M
Maximum Output120 Gb
Run Time11 to 29 hours
Sample ThroughputUp to 1 human genome; 12 exomes; 16 transcriptomes

Add to Compare List

Illumina

5200 Illumina Way

San Diego, CA 92122

United States

Phone: 858.202.4500

Company Profile

Website: http://illumina.com

(1) Integrated multi-omic and symptom clustering reveals lower-gastrointestinal disorders of gut-brain interaction heterogeneityGut MicrobesDecember 31, 2026Jarrah M. Dowrick, Nicole C. Roy, Caterina Carco, Shanalee C. James, Phoebe E. Heenan, Chris M. A. Frampton, Karl Fraser, Wayne Young, Janine Cooney, Tania Trower, et al.prepared using the Illumina Nextera XT kit. The final library was denatured and sequenced on an Illumina NextSeq 550 using the NextSeq 500/550 High Output Kit v2.5 (300 Cycles). Raw sequencing data analysis was performed

(2) Integrating tumor and immune cell transcriptomics to predict immune checkpoint inhibitor primary resistance in metastatic melanomaOncoImmunologyDecember 31, 2026Juan Luis Onieva, Elisabeth Pérez-Ruiz, Ville Vilkki, Miguel Berciano-Guerrero, Laura Figueroa-Ortiz, Manuel Zalabardo, Beatriz Martínez-Gálvez, Isabel Barragán, Antonio Rueda-DomínguezGenomics Single-Cell 3′ Library and Gel Bead Kit v3.1 Dual Index protocol (CG000315 Rev E). The Illumina NextSeq 550 and NovaSeq 6000 platforms were used for sequencing, and batch effects were accounted for in all analyzes. RNA-seq

(3) Continuity of eastern Beringian megafauna phylogenetic diversity following deposition of the Late Pleistocene Dawson tephraArctic, Antarctic, and Alpine ResearchDecember 31, 2026Ciara Wanket, Scott L. Cocker, Bianca De Sanctis, Myra Oliveira, Jeffrey Bond, Britta J. L. Jensen, Duane G. Froese, Beth Shapiropooled all libraries equimolarly. We sequenced each library to an average depth of 2.3 M reads on a NextSeq 550 on a 2 × 75 bp paired-end kit (Illumina) at the UC Santa Cruz Paleogenomics sequencing facility. Bioinformatics Preprocessing We

(4) Alcohol induces sorafenib resistance in hepatocellular carcinoma: A translational studyJournal of Molecular MedicineDecember 1, 2026Anoïsia Courtois, Constance Marié, Gregory Fouquet, Momar Diouf, Damien Esparteiro, Gérard Ducournau, Léa Marticho, Mickaël Naassila, Eric Nguyen-Khac, Ingrid Marcqwas quantified once again before pooling the libraries., cDNA were then sequenced with an Illumina NextSeq 550 device using a paired-end read length of 2 × 75 bases (NextSeq 500/550 High Output Kit v2.5). RNAseq

(5) Progression of nipah virus infection in the African green monkey: Role of macrophages and dendritic cells in early virus spreadiScienceJune 19, 2026Karla A. Fenton, Jacquelyn Turcinovic, Abhishek N. Prasad, Krystle N. Agans, Viktoriya Borisevich, Daniel J. Deer, Alyssa C. Fears, Natalie S. Dobias, Christopher C. Broder, Robert W. Cross, et al.libraries. Samples were sequenced to a target depth of 50 million 150 × 150 paired end reads on the NextSeq 550 (Illumina, Inc., San Diego, CA). Raw FASTQ files were aligned to the combined AGM (ChlSab1, Ensembl

(6) A single-cell multi-omics assay for simultaneous measurement of vector copy number and protein expression in CAR T cellsMolecular Therapy AdvancesJune 11, 2026Yilong Yang, Saurabh Parikh, Chieh-Yuan Li, Lindsey Murphy, Khushali Patel, Qawer Ayaz, Mahir Mohiuddin, John T. Elliott, Hua-Jun He, Zhiyong He, et al.library preparation. Sequencing was conducted using a 2 × 150 bp paired-end format on the Illumina NextSeq 550 platform. Comprehensive details on utilizing Tapestri’s single-cell sequencing, including necessary

(7) Drug resistant epilepsy driven by RHEB gene variants – Current evidence and a novel report of a paedatric caseEpilepsy & Behavior ReportsJune 1, 2026Ann-Louise Esserlind, Annie Pedersen, Frida Abel, Tove Hallbook, Colin Reilly, Daniel Nilsson, Tatjana Liakina, Thomas Olsson Bontell(https://genomicmedicine.se/wp-content/uploads/2023/11/GMS560_synopsis.pdf). The library was sequenced on an Illumina NextSeq 550 sequencer using 2 × 150 (paired-end) at 500-1500x vertical coverage to identify somatic mutations. Targeted sequencing

(8) Exploring genomic analysis and methylome profiling in longitudinal series of p.G12C KRAS mutated NSCLC patients treated with sotorasibThe Journal of Liquid BiopsyJune 1, 2026Francesco Pepe, Francesco Passiglia, Claudia Scimone, Gianluca Russo, Giuseppina Roscigno, Domenico Cozzolino, Angela Listì, Caterina De Luca, Edoardo Garbo, Luisella Righi, et al.in accordance with manufacturer procedures. Finally, TS and TMS pooled libraries were sequenced on NextSeq 550 Dx platform (Illumina, San Diego, USA) following manufacturer instructions. FASTQ files were manually

(9) Protocol for enhancing Cas9 efficiency and fidelity through structure-guided phosphate-locking loop engineeringSTAR ProtocolsJune 1, 2026Meiying Yang, Guanqiao Chen, Ji Xiao, Xin Zhang, Zheng Hu, Bo Zhou1.4,https://rbvi.ucsf.edu/chimera/download.html ,, Other,Other,Other ,, SF Cell Line 4D-Nucleofector X Kit,Lonza Scientific,Cat# V4XC-2024 Illumina NextSeq 550 System,Illumina,Cat#SY-415-1002 NextSeq 500/550 High Output Kit v2.5 (150 Cycles),Illumina,Cat#20024907 Qubit

(10) 30-hydroxygambogic acid activates overlapping and independent apoptotic pathways in HPV positive and HPV negative oral cancer cellsTumour Virus ResearchJune 1, 2026Danelle Grubbs, Sonia Whang, Valeria Rodarte, Briza Martinez, Valeri Filippov, John Chen, Jaqueline Coats, Julia Unternaehrer, Isaac Kremsky, Brigitte Vazquez, et al.different indices were diluted to 4 nM and pooled at equimolar amount for sequencing on a Illumina NextSeq 550 FlowCell with high output kit (Illumina, Inc., San Diego, CA). Single reads with 82 bp were generated. Illumina

(11) Ras-MAPK inhibition induces AXIN1 loss in colorectal cancer by mTOR associated suppression of protein synthesisCell Commun SignalMay 27, 2026Nachiyappan Venkatachalam, Li Wang, Niyumi Muthukumarana, Robert Ihnatko, Jeroen Krijgsveld, Olga Skabkina, Antonia Leipertz, Yubin Chen, Ping Sui, Qing Zheng, et al.manufacturer’s instructions. Libraries were multiplexed and sequenced as 80 nt long single-end reads on a NextSeq 550 sequencing device (Illumina). After removal of adapter sequences (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC)

(12) Targeted metatranscriptomic detection of viruses from floors for simultaneous evaluation of respiratory disease burden and viral variant identificationmSphereMay 26, 2026Amanda C. Carroll, Aaron Hinz, Alexandra M. A. Hicks, Engluy Khov, Tamara Van Bakel, Evgueni Doukhanine, Michael Fralick, Caroline Nott, Rees Kassen, Nisha Thampi, et al.including subtypes for some viruses (notably influenza). Sequencing was then carried out on an Illumina NextSeq550. All reads were analyzed using Kraken2 v2.1.3 using the standard RefSeq database (k2_standard_20230605

(13) A Genomic and Epigenetic Comparative Study of Low-grade Biphenotypic Sinonasal Sarcoma with Metachronous and Synchronous High-grade Rhabdomyosarcomatous TransformationHead Neck PatholMay 25, 2026Rayan M. Sibira, Constance Chen, Felipe D’. Almeida Costa, Anuj Verma, Poorva Singh, Jo Elle Peterson, Travis Hattery, Emilian Racila, Minghao Zhong, Paari Murugan, et al.assay (Integrated DNA Technologies). The enriched DNA libraries were sequenced on an Illumina MiSeq or NextSeq 550 instrument, and the resulting FASTQ files were processed through the GenomOncology a custom-developed

(14) Diagnosis complexity of dentinogenesis imperfecta involving DSPP genetic variantsJ Med GenetMay 25, 2026Gaétan Caravello, Alexandra Jiménez-Armijo, Marzena Kawczynski, Tristan Rey, on behalf of O-Rares Consortium, Manuela Antin, Alison Roth, Jean-Baptiste Lamouche, Aurélie Gouronc, Abdelmalek Alioua, et al.The Agilent SureSelect QXT protocol was used to prepare the libraries, and sequencing was done on a NextSeq 550 (Illumina, San Diego, USA). GenoDENT has been enforced in a diagnostic setting since 2018 allowing the

(15) Pilot-scale inoculum-free valorization of raw chicken feathers: ammonium recovery, keratinase production and community dynamicsWorld J Microbiol BiotechnolMay 25, 2026Fabio de-Santos-Casado, Carlos de la Fuente, Diego Martín-González, Sergio Bordel, Raúl Muñoz, Fernando Santos-Beneitand library quality and to estimate final DNA concentration. Sequencing was performed on an Illumina NextSeq 550 platform using paired-end chemistry (2 × 250–300 bp), allocating approximately 5% of a NextSeq vP1-600

(16) Predictive modeling of signal-responsive cis-elements in human red blood cell precursorsNucleic Acids ResMay 21, 2026Venkatasai Rahul Dogiparthi, Linda Chee, Pooja Roy, Yichao Zhou, M Jordan Rowley, Kyle J Hewittprepared using the TruSeq library preparation kits and paired-end sequenced (2 × 75 bp) on an Illumina NextSeq 550 platform. Raw FASTQ files were obtained from UNMC Sequencing Core Facility. HISAT 2.1.0 aligner was

(17) Nitric oxide drives proteomic diversity through alternative splicingMol CellMay 21, 2026Joseph C. Schindler, Puneet Seth, Alfred Hausladen, E. Ricky Chan, Jun Yang, Jun Qin, Zhaoxia Qian, Divya Seth, Kathleen Lundberg, Joseph M. Luna, et al.library preparation, and paired-end, 150nt sequencing with 30-40 million reads per sample using the NextSeq 550 Sequencing System (Illumina). Sequence reads were subjected to quality control filtering using Trim

(18) Redundant and distinct mechanisms suppress innate immune activation during SARS-CoV-2 infectionPLoS BiolMay 20, 2026Fuchun Zhou, Sivakumar Periasamy, Nathaniel D. Jackson, Wan Sze Cheng, Ruben Soto Acosta, Aarti Tripathi, Kritika Kedarinath, Philipp A. Ilinykh, Chengjin Ye, Shailendra Chauhan, et al.using AMPure XP SPRI beads (Beckman Coulter Life Sciences) and pooled for sequencing on an Illumina NextSeq 550 High Output Flow Cell using the single-end 75 base technique using AMPure XP SPRI beads (Beckman Coulter

(19) Characterization of Seminal Plasma Extracellular Vesicle MicroRNAs and Their Association with Boar Semen Quality During the Summer SeasonInt J Mol SciMay 19, 2026Notsile H. Dlamini, Serge L. Kameni, Shengfa F. Liao, Jean M. FeugangUSA). Samples were then submitted to Norgen Biotek Corp. for small RNA sequencing on the Illumina® NextSeq 550 platform (Illumina, Inc., San Diego, CA, USA). Sequencing libraries were prepared using the Norgen Biotek

(20) Host genetics shapes the recovery of the gut microbiome after antibiotic treatment: the role of the blood group related B4galnt2 genemSystemsMay 19, 2026Aleksa Čepić, Philipp Rausch, Theresa Geese, Astrid Dempfle, Guntram A. Grassl, John F. Bainestechnology, as described by the manufacturer (Illumina). The libraries were sequenced using the Illumina NextSeq 550 System High-Output kit. For selected RNA samples, ribosomal RNA depletion was performed using the QIAseq FastSelect

Be the First to Write a Review!