pCMVTNT Vector from Promega

Product Specs
ItempCMVTNT Vector
CompanyPromega
Price $155.00Supplier Page View Company Product Page
Catalog NumberL5620
Hostconstitutive expression in many cell types
PromoterSP6 and T7 polymerase promoters lie in tandem
MCSXho I, EcoR I, Mlu I, Kpn I, Xba I, Sal I, Acc I, Sma I, BstZ I, Not I
Vector NamepCMVTNT™
Quantity20microg
ResistanceAmpR

Specifications/Features

Vector Size:
4050 bp

Features:
• In Vivo Expression: The CMV enhancer/promoter region allows strong constitutive expression in many cell types.
• Flexible: The vector contains tandem SP6 and T7 phage promoters allowing use in the appropriate in vitro translation or transcription system.
• Convenient: Multiple cloning site provides a selection of restriction sites for cloning.

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) SHBs Mitigates Sorafenib‐Induced Apoptosis in Hepatocellular Carcinoma via Activation of RAF1/MEK/ERK Signaling PathwayCancer ScienceSeptember 1, 2025Shuxiang Wu, Yuxiang Hong, Hang Li, Mengxian Lin, Xiaohuang Lin, Xinjian Lin, Xu Lininserting the PCR‐amplified SHBs gene fused with a Flag tag into the EcoRI and XbaI sites of pCMVTN Vector (L5620; Promega) using the forward (5’‐CGGAATTCGCCACCATGGAGAACATCGCATCAGG‐3′) and reverse primer (5’‐GCTCTAGATTACTTATCGTCGTCATCCTTGTAATCAATGTATACCCAAAGAC‐3′).

(2) Ubiquitin-dependent proteasomal degradation of small hepatitis B virus surface antigen mediated by TRIM21 and antagonized by OTUD4Journal of VirologyMay 20, 2025Shuxiang Wu, Zhihan Chen, Zhengqian Zhang, Jing Xu, Hang Li, Mengxian Lin, Wenjie Xie, Yan Chen, Xinjian Lin, Xu LinpCMVTNT-SHBs-Flag was assembled by inserting PCR-amplified SHBs gene into pCMVTNT Vector (Promega, #L5620) using XhoI and KpnI sites. Additionally, various TRIM21 or OTUD4 deletion mutants were cloned into

(3) Engineered Cross-Linking to Study the Pore Architecture of the CRAC ChannelThe CRAC ChannelMarch 13, 2022Guolin Ma, Lian He, Ji Jing, Peng Tan, Yun Huang, Yubin Zhouby a KpnI site to aid convenient cloning into the pCMVTnT vector. pCMVTnT vector (Promega, cat.no. L5620). EcoRI-HF and KpnI-HF restriction endonucleases (e.g., New England Biolabs) with 1× CutSmart buffer

(4) Recruitment of MLL1 complex is essential for SETBP1 to induce myeloid transformationiScienceJanuary 21, 2022Nguyen N, Gudmundsson KO, Soltis AR, Oakley K, Roy KR, Han Y, Gurnari C, Maciejewski JP, Crouch G, Ernst P, et al.Ernst,Jude et al. (2007) ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, pCMVTNT,Promega,Cat# L5620 pMYs-IRES-GFP,Cell Biolabs,RTV-021 ,, Software and algorithms,Software and algorithms,Software and

(5) Resistance of Acta2R149C/+ mice to aortic disease is associated with defective release of mutant smooth muscle Î±-actin from the chaperonin-containing TCP1 folding complexJournal of Biological ChemistryDecember 1, 2021Jiyuan Chen, Kaveeta Kaw, Hailong Lu, Patricia M. Fagnant, Abhijnan Chattopadhyay, Xue Yan Duan, Zhen Zhou, Shuangtao Ma, Zhenan Liu, Jian Huang, et al.in vitro translation assays ACTA2 and ACTA1 were each cloned into the vector CMVTnT (Promega; catalog no. L5620) behind the T7 promoter. An additional 30 polyA tail was added after each gene for mRNA stability. All

(6) A Public Health Antibody Screening Indicates a 6-Fold Higher SARS-CoV-2 Exposure Rate than Reported Cases in ChildrenMed (N Y)February 1, 2021Markus Hippich, Lisa Holthaus, Robin Assfalg, Jose Zapardiel-Gonzalo, Heidi Kapfelsperger, Martin Heigermoser, Florian Haupt, Dominik A. Ewald, Tiziana C. Welzhofer, Benjamin A. Marcus, et al.Life Technologies,A14527; RRID:CVCL_D615 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, Plasmid pCMV-TnT,Promega,L5620 Plasmid IL6sp-secNluc-SARS-CoV-2-RBD,Vito Lampasona (this paper),N/A Plasmid Nluc-SARS-CoV-2- nucleocapsid,Vito

(7) Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 CellsChemical SensesOctober 26, 2019Fabio Miazzi, Carolin Hoyer, Silke Sachse, Markus Knaden, Dieter Wicher, Bill S Hansson, Sofia Lavista-Llanosthe termination regions of the pBI-CMV1 vector (Cat. Nr. 631630, Clontech), in the pCMVTNT (Cat. Nr. L5620, Promega) vector backbone. Both regions were amplified using Phusion high-fidelity polymerase (Cat.

Be the First to Write a Review!

pCMVTNT Vector

pCMVTNT Vector from Promega

Description

Specifications/Features

Promega

Citations (7)

Reviews

pCMVTNT Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map