AccessQuick RT-PCR System from Promega

Product Specs
ItemAccessQuick RT-PCR System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA1702
Quantity100 reactions

Specifications/Features

Kit Contents:
3 x 1ml AccessQuick™ Master Mix (2X), 1 x 500u AMV Reverse Transcriptase, 2 x 1.25ml Nuclease-Free Water

Comments:
A1702

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) An individual with multiple high-risk links uncovered: an epidemiological investigation based on molecular network analysisFrontiers in Public HealthFebruary 4, 2026Shijiao He, ShanShan Li, Qinying He, Fang Liu, Zhen Dai, Minjing Li, Fanghong Gong, Zhenhua Duan, Liang Wangprovince (16). The first round of RT-PCR and the second round of PCR were conducted via the Promega (A1702) Kit from the USA and the TIANGEN (KP201) Kit, respectively. PCR products were observed by 1% agarose gel electrophoresis

(2) Genetic transmission networks of HIV-1 CRF07_BC strain among HIV-1 infections with virologic failure of ART in a minority area of China: a population-based studyBMC Infectious DiseasesDecember 1, 2020Dan Yuan et al.reverse transcriptase regions. The first-round PCR was performed by the AccessQuick RT-PCR System (A1702) kit (Promega Biotechnology Co., Ltd., Beijing, China), and the second-round PCR was performed by the

(3) WNT5B governs the phenotype of basal-like breast cancer by activating WNT signalingCell Communication and SignalingDecember 1, 2019Shaojie Jiang et al.(Thermo Fisher Scientific, ND2000). Subsequent semi-RT-PCR was performed using the AccessQuick™ RT-PCR System (Promega, A1702). Semi-RT-PCR products were analyzed by electrophoresis on a 1% agarose gel. Primer sequences (F, forward;

(4) Improved reverse transcription-polymerase chain reaction assay for the detection of flaviviruses with semi-nested primers for discrimination between dengue virus serotypes and Zika virusMemórias do Instituto Oswaldo CruzFebruary 26, 2018Allan RD Nunes, Brenda Elen B Alves, Hannaly WB Pereira, Yasmin M Nascimento, Ingryd C Morais, José Veríssimo Fernandes, Josélio MG Araújo, Daniel CF LanzaUSA) according to the manufacturer’s protocol. The nested RT-PCR was performed using the Access RT-PCR A1702 Kit (Promega) with slight modification of the manufacturer’s protocol. A pre-treatment step was added

(5) Syndecan-1 suppresses epithelial-mesenchymal transition and migration in human oral cancer cellsOncology ReportsFebruary 14, 2018Xiaofeng Wang, Jinting He, Xiaoming Zhao, Tianyang Qi, Tianfu Zhang, Chenfei KongCO2. Quantitative PCR (qPCR). Total RNA was reverse transcribed using the RT system supplied by Promega (cat. no. A1702; Madison, WI, USA) and qPCR was performed on a Mastercycler supplied by Eppendorf (Hamburg, Germany). The

(6) Chikungunya Virus Infections Among Patients with Dengue-Like Illness at a Tertiary Care Hospital in the Philippines, 2012â€“2013The American Journal of Tropical Medicine and HygieneDecember 9, 2015John Mark Velasco, Maria Theresa Poolpanichupatam, Maria Nila Roque, Kittinun Hussem, Rene Latog, Maria Theresa Valderama, Domingo Corpuz, Chonticha Klungthong, Prinyada Rodpradit, Maria Nila Hussem, Yongyuth Poolpanichupatam, Chonticha Klungthong, Stefan Fernandez, In-Kyu Corpuz

(7) Effect of lipopolysaccharide on angiotensin II type 1 receptor expression and function in human pulmonary microvascular endothelial cellsMolecular medicine reportsDecember 1, 2015Li HP, Qiu HB, Wang HQ.no. FI120611) were purchased from Abcam (Cambridge, MA, USA). The AccessQuick RT‑PCR system (Promega-A1702)was purchased from Promega Corp. (Madison, WI, USA). HPMECs (cat. no. 3000), endothelial cell medium

(8) Emergence of Highly Pathogenic Avian Influenza A(H5N1) Virus PB1-F2 Variants and Their Virulence in BALB/c MiceJournal of VirologyJune 1, 2015Ram P. Kamal, Amrita Kumar, Charles T. Davis, Wen-Pin Tzeng, Tung Nguyen, Ruben O. Donis, Jacqueline M. Katz, Ian A. Yorkreverse transcribed, and amplified by the AccessQuick reverse transcription (RT)-PCR system (catalog no. A1702; Promega Corporation, USA). Sequencing reactions were performed by using the BigDye Terminator v3.1 cycle sequencing kit

(9) Detection of Murine Leukemia Virus or Mouse DNA in Commercial RT-PCR Reagents and Human DNAsPLoS ONEDecember 20, 2011HaoQiang Zheng, Hongwei Jia, Anupama Shankar, Walid Heneine, William M. Switzercontrast, AMV RTs in two kits from Promega (Access RT-PCR (cat# A1259) and AccessQuick RT-PCR (cat# A1702) systems, Madison, WI) were both negative in all 16 replicates (Table 1). None of the enzymes with detectable

(10) Prevention of MDR development in leukemia cells by micelle-forming polymeric surfactantJournal of Controlled ReleaseNovember 12, 2008Amit K. Sharma, Li Zhang, Shu Li, David L. Kelly, Valery Yu. Alakhov, Elena V. Batrakova, Alexander V. KabanovAMV reverse transcriptase were prepared using AccessQuick™ RT-PCR system (Promega, Madison, WI, USA, Cat#A1702). PCR amplifications were carried out with PCR Sprint Cycler (Thermo Electron Corp., Milford, MA) as

(11) Nitric oxide and interlukin-6 levels in intellectual disability adults with epilepsyResearch in Developmental DisabilitiesAugust 20, 2008Eli Carmeli, Reut Beiker, Mohammed Morad

(12) The expression of MMP-2 following immobilization and high-intensity running in plantaris muscle fiber in ratsTheScientificWorldJournalMay 5, 2006Carmeli E, Haimovitch TG.Haemek, Israel). RNA was used as a template for RT-PCR reaction (Access QuickTM RT-PCR system, Promega A1702) using MMP-2 primers: sense (Forward) CCATCAAACGGGTATCCATC and antisense (Backward) GTCGGACCTCTCAGGGTTCT;

(13) CNBP regulates forebrain formation at organogenesis stage in chick embryosDevelopmental BiologyMarch 13, 2006Yoko Abe, Wei Chen, Wei Huang, Mizuho Nishino, Yi-Ping Li

Be the First to Write a Review!