UNR siRNA (m) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemUNR siRNA (m)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-76809
Gene Namecold shock domain containing E1, RNA-binding
Quantity10 µM
Speciesmouse
NCBI Full Gene Namecold shock domain containing E1, RNA binding
NCBI Gene AliasesD3Jfr1, mKIAA0885, unr
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Cytolethal distending toxin induces the formation of transient messenger-rich ribonucleoprotein nuclear invaginations in surviving cellsPLOS PathogensSeptember 30, 2019Lamia Azzi-Martin et al.using a pool of 3 target-specific 19–25 nucleotide siRNAs designed to knock down UNR gene expression (sc-76809, Santa Cruz Biotechnology, Heidelberg, Germany). Transgenic Hep3B cells (Table 1) were grown in 12-wells

(2) The DDX6–4E-T interaction mediates translational repression and P-body assemblyNucleic Acids ResearchJuly 27, 2016Anastasiia Kamenska, Clare Simpson, Caroline Vindry, Helen Broomhead, Marianne Bénard, Michèle Ernoult-Lange, Benjamin P. Lee, Lorna W. Harries, Dominique Weil, Nancy Standartunrip 1:1 mix of AAACUGUUACGCAUAUAUGAC[dT][dT] and AACUUAUGGACGAUCUAUUGC[dT][dT] (38); UNR Santa Cruz, sc-76809, DDX6 GGAACUAUGAAGACUUAAA[dT][dT] and β-globin GGUGAAUGUGGAAGAAGU[dT][dT (39). Mass spectrometry HEK293T

Be the First to Write a Review!

UNR siRNA (m)

UNR siRNA (m) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (2)

Reviews

UNR siRNA (m) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map