Syntaxin 17 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemSyntaxin 17 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-92492
Gene Namesyntaxin 17
Quantity10 µM
Specieshuman
NCBI Full Gene Namesyntaxin 17
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Phosphoribosyl ubiquitination of SNARE proteins regulates autophagy during Legionella infectionThe EMBO JournalJune 12, 2025Rukmini Mukherjee, Anshu Bhattacharya, Ines Tomaskovic, João Mello-Vieira, Melinda Elaine Brunstein, Marion Başoğlu, Tineke Veenendaal, Henry Bailey, Thomas Colby, Mohit Misra, et al.(TP500318). Antibodies and siRNA Human STX17 siRNA was used from Santa Cruz Biotechnology (catalog no: sc-92492). We used the following antibodies and dilutions: STX17 (cat. no. 17815-1-AP, Proteintech; 1:1000),

(2) Cancer cells escape autophagy inhibition via NRF2-induced macropinocytosisCancer cellMay 10, 2021Su H, Yang F, Fu R, Li X, French R, Mose E, Pu X, Trinh B, Kumar A, Liu J, et al.sequence of mouse Ikkα/Chuk: GCAGCAATGTTAAGTCTTCTT,This paper,N/A Human STX17 siRNA,Santa Cruz,Cat# sc-92492 "Primers for analysis of gene-expression changes, see EXPERIMENTAL MODEL AND SUBJECT DETAILS",This

(3) 2BC Non-Structural Protein of Enterovirus A71 Interacts with SNARE Proteins to Trigger Autolysosome FormationVirusesJuly 4, 2017Lai JKF, Sam IC, Verlhac P, Baguet J, Eskelinen EL, Faure M, Chan YF.

(4) The Autophagosomal SNARE Protein Syntaxin 17 Is an Essential Factor for the Hepatitis C Virus Life CycleJournal of virologyJuly 1, 2016Ren H, Elgner F, Jiang B, Himmelsbach K, Medvedev R, Ploen D, Hildt E.

Be the First to Write a Review!