GCN2 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemGCN2 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-45644
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
Quantity10 µM
Specieshuman
NCBI Full Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
NCBI Gene AliasesGCN2, PVOD2
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Activating GCN2 and subsequently the Unfolded Protein Response with the small oral molecule NXP800 delays tumor growth in osteosarcomaCell Death DiscovFebruary 5, 2026Emma Racineau, Morgane Lallier, Anaïs Postec, Jérôme Amiaud, Rose-Anne Thépault, Régis Brion, Séverine Battaglia, Céline Charrier, Marie-Anne Colle, Bénédicte Brounais-Le Royer, et al.(Invitrogen) was used as a transfection agent according to the manufacturer’s recommendations. siGCN2 (sc-45644, Santa Cruz Biotechnology), siHSF1 (sc-35611, Santa Cruz Biotechnology) and control siRNA (4457287,

(2) Inhibition of the Integrated stress response by Epstein-Barr virus oncoprotein LMP1 attenuates epithelial cell differentiation and lytic viral reactivationPLoS PathogFebruary 14, 2025Deo R. Singh, Yitao Zhang, Sophia J. White, Scott E. Nelson, Stuart A. Fogarty, Abigail S. Pawelski, Alisha S. Kansra, Shannon C. Kenneyfor western blot analysis. siRNAs siRNAs against KLF4 (sc-35437), BLIMP1 (sc-37714), PERK (sc-36213), GCN2 (sc-45644), ATF4 (sc-35112), and control siRNAs A and C (sc-37007, sc-44230) were purchased from Santa Cruz. For

(3) Targeting ERK-MYD88 interaction leads to ERK dysregulation and immunogenic cancer cell deathNature communicationsAugust 15, 2024Virard F, Giraud S, Bonnet M, Magadoux L, Martin L, Pham TH, Skafi N, Deneuve S, Frem R, Villoutreix BO, et al.ON-TARGETplus SMARTpool human siRNAs were purchased from Dharmacon,. GCN2 siRNA was purchased from Santa Cruz (sc-45644) and non-targeting siRNA from Eurofin Genomics. Antibodies used are listed in Supplementary Table 4. Homogeneous

(4) The stress sensor GCN2 differentially controls ribosome biogenesis in colon cancer according to the nutritional contextMolecular oncologyJuly 15, 2023Piecyk M, Triki M, Laval PA, Duret C, Fauvre J, Cussonneau L, Machon C, Guitton J, Rama N, Gibert B, et al.

(5) Amino acid deprivation induces AKT activation by inducing GCN2/ATF4/REDD1 axisCell death & diseaseDecember 3, 2021Jin HO, Hong SE, Kim JY, Jang SK, Park IC.plasmid encoding mouse wild-type ATF4 (pEF/mATF4-myc) was kindly provided by Dr. Jawed Alam [30]. GCN2 (#sc-45644), ATF4 (#sc-35112), REDD1 (#sc-45806), Rictor (#sc-61478), Sin1 (#sc-60984) and control (#sc-37007)

(6) Lysine is required for growth factor-induced mTORC1 activationBiochemical and biophysical research communicationsDecember 17, 2020Jang SK, Hong SE, Lee DH, Hong J, Park IC, Jin HO.

(7) Regulation of the unfolded protein response through ATF4 and FAM129A in prostate cancerOncogeneAugust 1, 2019Pällmann N, Livgård M, Tesikova M, Zeynep Nenseth H, Akkus E, Sikkeland J, Jin Y, Koc D, Kuzu OF, Pradhan M, et al.siRNA siATF4-1 Dharmacon L-005125 CAGATTGGATGTTGGAGAA, CGACTTGGATGCCCTGTTG, GAAGAACGAGGCTCTAAAA, GAGATAGGAAGCCAGACTA siATF4-2 Qiagen SI03019345 CAGCGTTGCTGTAACCGACAA siCEBPB Qiagen SI02777292 CGGGCCCTGAGTAATCGCTTA SI03058062 CACCCTGCGGAACTTGTTCAA SI03022341 TTCCGTTTCAAGCATTAAGAA SI00073640 CCCGTGGTGTTATTTAAAGAA siFAM-1 Qiagen SI04167219 CACGTGCGCACTGAAGTAGAA siFAM-2 Qiagen - AGAGATTTAACGTCACAGTTT siPKR Santa Cruz sc-36263 N/A siPERK Santa Cruz sc-36213 N/A siGCN2 Santa Cruz sc-45644 N/A Quantitative PCR mRNA expression in human tissues was assessed by using human cDNA panels (Clontech,

(8) Chemical compounds that suppress hypoxia-induced stress granule formation enhance cancer drug sensitivity of human cervical cancer HeLa cellsJournal of biochemistryNovember 1, 2018Timalsina S, Arimoto-Matsuzaki K, Kitamura M, Xu X, Wenzhe Q, Ishigami-Yuasa M, Kagechika H, Hata Y.

(9) GCN2 is a potential prognostic biomarker for human papillary renal cell carcinomaCancer biomarkers : section A of Disease markersJanuary 1, 2018Ge L, Chen W, Cao W, Liu G, Zhang Q, Zhuang J, Zhang M, Yang J, Guo S, Zhao X, et al.

(10) Host-Virus Protein Interaction Network Reveals the Involvement of Multiple Host Processes in the Life Cycle of Hepatitis E VirusmSystemsJanuary 1, 2018Subramani C, Nair VP, Anang S, Mandal SD, Pareek M, Kaushik N, Srivastava A, Saha S, Shalimar, Nayak B, et al.Control siRNAs (SC-37007) or target-speciﬁc siRNAs (pools of three targetspeciﬁc siRNAs) against eIF2AK4 (SC-45644), eIF4A2 (SC-40556), RACK1 (SC-36354), eIF3A (SC-40547), and ACTG1 (SC-105037) were from Santa Cruz Biotechnology

(11) Arginine starvation kills tumor cells through aspartate exhaustion and mitochondrial dysfunctionCommunications biologyJanuary 1, 2018Cheng CT, Qi Y, Wang YC, Chi KK, Chung Y, Ouyang C, Chen YR, Oh ME, Sheng X, Tang Y, et al.as specified for 3 days. TSC1 (sc-37437), TSC2 (sc-36762), ATF3 (sc-29757), ATF4 (sc-35112), GCN2 (sc-45644) siRNAs were purchased from Santa Cruz. Each siRNA product is a pool of 3 target-specific siRNAs of

(12) Nutrient shortage triggers the hexosamine biosynthetic pathway via the GCN2-ATF4 signalling pathwayScientific reportsJune 3, 2016Chaveroux C, Sarcinelli C, Barbet V, Belfeki S, Barthelaix A, Ferraro-Peyret C, Lebecque S, Renno T, Bruhat A, Fafournoux P, et al.siRNA delivery HBEC 3KT-RL cells were transfected with either known human siRNAs in the case of GCN2 (sc-45644), ATF4 (sc-35112), XBP1 (sc-38627) and scrambled siRNA (sc-37007) (Santa Cruz Biotechnology), or with

(13) Activation of the EIF2AK4-EIF2A/eIF2α-ATF4 pathway triggers autophagy response to Crohn disease-associated adherent-invasive Escherichia coli infectionAutophagyMay 3, 2016Bretin A, Carrière J, Dalmasso G, Bergougnoux A, B'chir W, Maurin AC, Müller S, Seibold F, Barnich N, Bruhat A, et al.

(14) Malonate induces the assembly of cytoplasmic stress granulesFEBS lettersJanuary 1, 2016Fu X, Gao X, Ge L, Cui X, Su C, Yang W, Sun X, Zhang W, Yao Z, Yang X, et al.

(15) Involvement of general control nonderepressible kinase 2 in cancer cell apoptosis by posttranslational mechanismsMolecular biology of the cellMarch 15, 2015Wei C, Lin M, Jinjun B, Su F, Dan C, Yan C, Jie Y, Jin Z, Zi-Chun H, Wu Y.synthesized double-stranded siRNAs were purchased from Genepharma (Shanghai, China). GCN2 siRNA (h) (sc-45644), PERK siRNA (h) (sc-36213), PKR siRNA (h) (sc-36263), and CHOP siRNA (h) (sc-35437) were purchased

(16) Activation of GCN2 upon HIV-1 infection and inhibition of translationCellular and molecular life sciences : CMLSJuly 1, 2013Cosnefroy O, Jaspart A, Calmels C, Parissi V, Fleury H, Ventura M, Reigadas S, Andréola ML.

(17) Depletion of L-arginine induces autophagy as a cytoprotective response to endoplasmic reticulum stress in human T lymphocytesAutophagyNovember 1, 2012García-Navas R, Munder M, Mollinedo F.

(18) The role of nitric-oxide synthase in the regulation of UVB light-induced phosphorylation of the alpha subunit of eukaryotic initiation factor 2The Journal of biological chemistrySeptember 4, 2009Lu W, László CF, Miao Z, Chen H, Wu S.

Be the First to Write a Review!

GCN2 siRNA (h)

GCN2 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (18)

Reviews

GCN2 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map