AMPKα1/2 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemAMPKα1/2 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-45312
Gene Nameprotein kinase, AMP-activated, alpha 2 catalytic subunit
Quantity10 µM
Specieshuman
NCBI Full Gene Nameprotein kinase AMP-activated catalytic subunit alpha 2, protein kinase AMP-activated catalytic subunit alpha 1
NCBI Gene AliasesAMPK, AMPK alpha 1, PRKAA, AMPK2, AMPKa1, AMPKa2
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Obestatin Treatment Counteracts Muscle Wasting by Reactivation of Autophagy in Duchenne Muscular DystrophyMedComm (2020)January 14, 2026Icía Santos‐Zas, Silvia Costas‐Abalde, Andrea C. Lodeiro, Fátima Fernández‐Barreiro, Tania Cid‐Díaz, Saúl Leal‐López, Jessica González‐Sánchez, Mar García‐Lamela, Lucía Debasa‐Corral, Carlos S. Mosteiro, et al.expression, siRNA specifically targeting human NEDD4‐L (sc‐75894; Santa Cruz Biotechnology, CA, USA), AMPKα (sc‐45312; Santa Cruz Biotechnology), or USP10 (sc‐76811; Santa Cruz Biotechnology) was used. siRNA duplexes targeting

(2) Accelerated cartilage regeneration via chondrocyte metabolic reprogramming using nano-steroid-conjugated mesenchymal stem cells in osteoarthritisTheranosticsJanuary 1, 2026Jong Yeong Lee, Jun Young Park, In Ah Kwon, Su Hyun Lim, Ki Bum Kim, Jun-Young Park, Youn Joo Kang, Sang-Hyun Kim, Dongwoo Khang, Jin Kyeong Choitransfection Chondrocytes were transfected with siRNAs targeting DDIT4 (sc-45806; Santa Cruz Biotechnology) or AMPKα1/2 (sc-45312; Santa Cruz Biotechnology), along with a non-targeting control siRNA (sc-37007; Santa Cruz Biotechnology),

(3) Metformin as antiviral therapy protects hyperglycemic and diabetic patientsmBioJune 11, 2025Xi Wang, Xiaojie Zheng, Honghan Ge, Ning Cui, Ling Lin, Ming Yue, Chuanlong Zhu, Qi Zhou, Peixin Song, Xing Shang, et al.of transfection. The specific siRNA for AMPKα1/2 was purchased from Santa Cruz Biotechnology (Cat. sc-45312). The negative control siRNA: 5′-UUCUCCGAACGUGUCACGUTT-3′ was synthesized by GenePharma Co., Ltd (Jiangsu,

(4) Nitazoxanide Modulates Mitochondrial Function and Inflammatory Metabolism in Chondrocytes from Patients with Osteoarthritis via AMPK/mTORC1 SignalingAntioxidants (Basel)April 24, 2025Ha Eun Kim, Jong Yeong Lee, Ga-Yeon Son, Jun-Young Park, Ki Bum Kim, Chul-Min Choi, Young Jae Moon, Jin Kyeong Choisilence AMPK expression, human primary chondrocytes were transfected with siRNA targeting AMPKα1/2 (Cat# sc-45312, Santa Cruz Biotechnology, Dallas, TX, USA) or a non-targeting control siRNA (Cat# sc-37007) using the

(5) Tomatine Improves Glucose Metabolism and Mitochondrial Respiration in Insulin-Resistant Hepatocyte Cell Lines AML12 and HepG2 via an AMP-Activated Protein Kinase-Dependent PathwayCellsFebruary 23, 2025Yu Geon Lee, Donghwan Kimnontargeting siRNA (siCtrl, #sc-37007, Santa Cruz Biotechnology), human AMPK1/2-targeting siRNA (siAMPK, #sc-45312, Santa Cruz Biotechnology), or mouse siAMPK (#sc-45313, Santa Cruz Biotechnology) to knock down AMPK

(6) Small molecule-driven LKB1 deacetylation is responsible for the inhibition of hepatic lipid response in NAFLDJournal of Lipid ResearchFebruary 1, 2025Weiwei Qin, Yu Ding, Wenhao Zhang, Lu Sun, Jianping Weng, Xueying Zheng, Sihui Luoalanine (D194A), as detailed in a previous study (29). We purchased AMPKα1/2-specific siRNA duplex (sc-45312) and control siRNA (sc-37007) from Santa Cruz Biotechnology and transfected the cells using transfection reagent

(7) Pro-survival signaling regulates lipophagy essential for multiple myeloma resistance to stress-induced deathCell ReportsJuly 23, 2024Peng Peng, Colin Chavel, Wensheng Liu, Louise M. Carlson, Sha Cao, Adam Utley, Scott H. Olejniczak, Kelvin P. LeeDiscovery,Cat#L-003773-00 Non-Targeting Pool,Horizon Discovery,Cat#D-001810-10-05 AMPK Alpha 1/2 siRNA,Santa Cruz,Cat#Sc45312 Control siRNA-A,Santa Cruz,Cat#Sc37007 ATG5 F primer,Invitrogen,GCAAGCCAGACAGGAAAAAG ATG5 R primer,Invitrogen,GACCTTCAGTGGTCCGGTAA PP1B

(8) AMPK-HIF-1α signaling enhances glucose-derived de novo serine biosynthesis to promote glioblastoma growthJournal of experimental & clinical cancer research : CRDecember 15, 2023Yun HJ, Li M, Guo D, Jeon SM, Park SH, Lim JS, Lee SB, Liu R, Du L, Kim SH, et al.performed according to the assay kit instructions. siRNA and shRNA transfection AMPKα1/2 siRNA (#sc-45312) was purchased from Santa Cruz (Dallas, TX). HIF-1α siRNA (#104,730,345) was purchased from Integrated

(9) AMPK activator-treated human cardiac spheres enhance maturation and enable pathological modelingStem Cell Research & TherapyNovember 8, 2023Dong Li, Lawrence C. Armand, Fangxu Sun, Hyun Hwang, David Wolfson, Antonio Rampoldi, Rui Liu, Parvin Forghani, Xin Hu, Wen-Mei Yu, et al.Stress test. AMPK knockdown using small interfering RNA Small interfering RNAs (siRNA) against AMPKα1/α2 (sc-45312) and control siRNA (sc-37007) were purchased from Santa Cruz Biotechnology, Inc. On differentiation

(10) Auraptene Enhances AMP-Activated Protein Kinase Phosphorylation and Thereby Inhibits the Proliferation, Migration and Expression of Androgen Receptors and Prostate-Specific Antigens in Prostate Cancer CellsInternational Journal of Molecular SciencesNovember 6, 2023Yasuyuki Akasaka, Shun Hasei, Yukino Ohata, Machi Kanna, Yusuke Nakatsu, Hideyuki Sakoda, Midori Fujishiro, Akifumi Kushiyama, Hiraku Ono, Akio Matsubara, et al.either 20 μM of negative siRNA (QIAGEN, Venlo, The Netherlands) or human AMPKα1/2 siRNA (Santa Cruz, sc-45312) for 72 h. 4.7. Real-Time Quantitative PCR Total RNA was extracted from LNCaP cells using Sepasol

(11) Autophagy-urea cycle pathway is essential for the statin-mediated nitric oxide bioavailability in endothelial cellsJournal of Food and Drug AnalysisAugust 31, 2023Wen-Hua Chen, Bei-Chia Guo, Chia-Hui Chen, Man-Chen Hsu, Chih-Hsien Wang, Tzong-Shyuan LeeTaiwan). Mouse antibody against ASL (sc-166787), ATG7 siRNA (siATG7, sc-41447), AMPK siRNA (siAMPK, sc-45312), and ASL siRNA (siASL, sc-61998) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

(12) AMPK/FOXO3a Pathway Increases Activity and/or Expression of ATM, DNA-PKcs, Src, EGFR, PDK1, and SOD2 and Induces Radioresistance under Nutrient StarvationInternational journal of molecular sciencesAugust 15, 2023Urushihara Y, Hashimoto T, Fujishima Y, Hosoi Y.USA). 4.6. Small Interfering RNA (siRNA) RNA silencing was achieved with a siRNA specific for AMPKα1/2 (#sc-45312, Santa Cruz Biotechnology, Inc.) or FOXO3a (#J-003007-09, GE Healthcare Dharmacon, Inc., Lafayette,

(13) Metformin inhibits methylglyoxal-induced retinal pigment epithelial cell death and retinopathy via AMPK-dependent mechanisms: Reversing mitochondrial dysfunction and upregulating glyoxalase 1Redox biologyAugust 1, 2023Sekar P, Hsiao G, Hsu SH, Huang DY, Lin WW, Chan CM.for 24 h before they were subjected to further analysis. 2.9 RNA interference Human si-AMPKα1/2 (sc-45312) and scramble nonspecific siRNA (sc-44236) were purchased from Santa Cruz Biotechnology (Dallas, Texas,

(14) Caffeic acid phenethyl ester inhibits the growth of bladder carcinoma cells by upregulating growth differentiation factor 15Biomedical journalOctober 1, 2022Hou CP, Tsui KH, Chang KS, Sung HC, Hsu SY, Lin YH, Yang PS, Chen CL, Feng TH, Juang HH.

(15) Abietic acid alleviates endoplasmic reticulum stress and lipid accumulation in human primary hepatocytes through the AMPK/ORP150 signalingBiochemical and biophysical research communicationsJune 11, 2022Jung TW, Jeong JC, Park SY, Cho W, Oh H, Lee HJ, Hacimuftuoglu A, Abd El-Aty AM, Bang JS, Jeong JH.

(16) PFKP alleviates glucose starvation-induced metabolic stress in lung cancer cells via AMPK-ACC2 dependent fatty acid oxidationCell discoveryMay 31, 2022Chen J, Zou L, Lu G, Grinchuk O, Fang L, Ong DST, Taneja R, Ong CN, Shen HM.PFKP siRNA (sc-106401), ACC2 siRNA (sc-43597), siVDAC1 (sc-42355), siVDAC2 (sc-42357), siAMPKα1/2 (sc-45312), and control siRNA (sc-37007) were purchased from Santa Cruz. The lipofectamine 3000 (Thermo Fisher,

(17) Novel Inhibitor for Downstream Targeting of Transforming Growth Factor-β Signaling to Suppress Epithelial to Mesenchymal Transition and Cell MigrationInternational journal of molecular sciencesMay 2, 2022Toma T, Tateishi H, Kawakami K, Ali TFS, Kamo M, Monde K, Nakashima Y, Fujita M, Otsuka M.

(18) Intestinal AMPK modulation of microbiota mediates crosstalk with brown fat to control thermogenesisNature communicationsMarch 3, 2022Zhang E, Jin L, Wang Y, Tu J, Zheng R, Ding L, Fang Z, Fan M, Al-Abdullah I, Natarajan R, et al.for experiments. AMPK knockdown in cells HT-29 cells were transfected with siRNA targeting PRKAA1 (sc-45312, Santa Cruz Biotechnology) or a control siRNA (SIC001, Sigma) using Lipofectamine 3000 (11668-027, Invitrogen)

(19) Ilexgenin A restrains CRTC2 in the cytoplasm to prevent SREBP1 maturation via AMP kinase activation in the liverBritish journal of pharmacologyMarch 1, 2022Lu Y, Ma J, Li P, Liu B, Wen X, Yang J.

(20) AMPK increases expression of ATM through transcriptional factor Sp1 and induces radioresistance under severe hypoxia in glioblastoma cell linesBiochemical and biophysical research communicationsJanuary 29, 2022Hashimoto T, Urushihara Y, Murata Y, Fujishima Y, Hosoi Y.

Be the First to Write a Review!

AMPKα1/2 siRNA (h)

AMPKα1/2 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (181)

Reviews

AMPKα1/2 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map