TPR siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemTPR siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-45343
Gene Nametranslocated promoter region (to activated MET oncogene)
Quantity10 µM
Specieshuman
NCBI Full Gene Nametranslocated promoter region, nuclear basket protein
NCBI Gene AliasesMRT79
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Long noncoding RNA TLNC1 promotes the growth and metastasis of liver cancer via inhibition of p53 signalingMolecular cancerApril 27, 2022Yuan K, Lan J, Xu L, Feng X, Liao H, Xie K, Wu H, Zeng Y.

(2) Confinement hinders motility by inducing RhoA-mediated nuclear influx, volume expansion, and blebbingThe Journal of cell biologyDecember 2, 2019Mistriotis P, Wisniewski EO, Bera K, Keys J, Li Y, Tuntithavornwat S, Law RA, Perez-Gonzalez NA, Erdogmus E, Zhang Y, et al.24 h with media containing lentiviral particles. For siRNA knockdown, scramble (sc-37007) and TPR (sc-45343) siRNA were purchased from Santa Cruz Biotechnology. Cells were transiently transfected with siRNA using

(3) Colorectal cancer cells require glycogen synthase kinase-3β for sustaining mitosis via translocated promoter region (TPR)-dynein interactionOncotargetMarch 2, 2018Dewi FRP, Domoto T, Hazawa M, Kobayashi A, Douwaki T, Minamoto T, Wong RW.interfering (si)RNA duplexes targeting GSK3β (5′-AUCUAGCUUUCUCAUGAUCUGGAGC-3′), TPR-specific siRNA (sc-45343), and control siRNA (sc-37007) were purchased from Santa Cruz Biotechnology. Plasmid and siRNA were

(4) ROCK-dependent phosphorylation of NUP62 regulates p63 nuclear transport and squamous cell carcinoma proliferationEMBO reportsJanuary 1, 2018Hazawa M, Lin DC, Kobayashi A, Jiang YY, Xu L, Dewi FRP, Mohamed MS, Hartono, Nakada M, Meguro-Horike M, et al.background subtracted and Company Control Sigma-Aldrich SIC001 NUP107 Santa Cruz Biotechnology sc-45343 Smad7-R CAAAGCTGATCTGCACGGTA CTGGCTCAGCACCTCTATCC NUP85 Life Technologies 4392420 FASN-F NUP62 Sigma-Aldrich SASI_Hs01_00038069 FASN-R CAGGTTGTCCCTGTGATCCT GCTCTTACGGCAAGGTGAAG NUP54 Santa Cruz Biotechnology

(5) Antagonist of thromboxane A2 receptor by SQ29548 lowers DOCA-induced hypertension in diabetic ratsEuropean journal of pharmacologyNovember 15, 2017Sun P, Sun H, Zhang W, Du Z.

(6) Hyperglycemia via activation of thromboxane A2 receptor impairs the integrity and function of blood-brain barrier in microvascular endothelial cellsOncotargetMay 2, 2017Zhao Z, Hu J, Gao X, Liang H, Yu H, Liu S, Liu Z.

(7) Identification of replication-dependent and replication-independent linker histone complexes: Tpr specifically promotes replication-dependent linker histone stabilityBMC biochemistryOctober 1, 2016Zhang P, Branson OE, Freitas MA, Parthun MR.immunofluorescence microscopy; anti-Tpr from Abcam. Control siRNA (sc-37007) and siRNA targeting Tpr (sc-45343) was purchased from Santa Cruz Biotech. Plasmid construction The human Ultimate ORF of histone H1.1

(8) Therapeutic potential of mitotic interaction between the nucleoporin Tpr and aurora kinase ACell cycle (Georgetown, Tex.)January 1, 2015Kobayashi A, Hashizume C, Dowaki T, Wong RW.

(9) Regulation of autophagy by nucleoporin TprScientific reportsJanuary 1, 2012Funasaka T, Tsuka E, Wong RW.was a kind gift from Dr. Larry Gerace (The Scripps Research Institute). siRNA duplexes targeting Tpr (sc-45343), CRM1 (sc-35116) and control siRNA (sc-37007) were purchased from Santa Cruz Biotechnology. siRNA transfections

(10) Nucleoporin translocated promoter region (Tpr) associates with dynein complex, preventing chromosome lagging formation during mitosisThe Journal of biological chemistryApril 2, 2010Nakano H, Funasaka T, Hashizume C, Wong RW.

Be the First to Write a Review!

TPR siRNA (h)

TPR siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (10)

Reviews

TPR siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map