survivin siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
Itemsurvivin siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29499
Gene Namebaculoviral IAP repeat containing 5
Quantity10 µM
Specieshuman
NCBI Full Gene Namebaculoviral IAP repeat containing 5
NCBI Gene AliasesAPI4, EPR-1
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Baculoviral Inhibitor of Apoptosis Repeat Containing 5 (BIRC5) Regulates Cancer Stem Cell Properties and Epithelial-Mesenchymal Transition in Human Breast Cancer CellsDev ReprodJune 30, 2026Jin young Jang, Rae-Kwon Kimbaculoviral inhibitor of apoptosis repeat containing 5 Cells were transfected with BIRC5-specific siRNA (sc-29499, Santa Cruz Biotechnology) using Lipofectamine RNAiMAX (13-778-150, Invitrogen, Thermo Fisher Scientific)

(2) E3 ligase Skp2-mediated stabilization of survivin contributes to radioresistanceCell Death DiscovApril 7, 2025Shiming Tan, Ruirui Wang, Jinglin Fang, Ming Yi, Pengfei Guo, Shuangze Han, Xiaoying Li, Yu Gan, Jinzhuang Liao, Xinfang Yu, et al.experiment: sgRNA#1 for Skp2: CCAGAGACCTTTAGCAGCTC; sgRNA#2 for Skp2: TCCCTCCAAAGGTGTTTCAT; siSurvivin (sc-29499), siFBXL7 (sc-62306), and siXIAP (sc-37508) were purchased from Santa Cruz Biotechnology. MTS assay To

(3) Post-transcriptional regulation of BIRC5/survivin expression and induction of apoptosis in breast cancer cells by tristetraprolinRNA BiologyDecember 31, 2024Suhad Al-Yahya, Maher Al-Saif, Maha Al-Ghamdi, Walid Moghrabi, Khalid S.A. Khabar, Norah Al-Souhibanicontrols, were custom-made by Metabion (Germany). BIRC5 siRNA was purchased from Santa Cruz Biotechnology (sc-29499, Santa Cruz, CA, USA). The efficiency of siRNA silencing was determined by immunoblotting. After transfection

(4) USP36 inhibits apoptosis by deubiquitinating cIAP1 and survivin in colorectal cancer cellsJournal of Biological ChemistryJuly 1, 2024Bao Gao, Yuan Qiao, Shan Zhu, Ning Yang, Shan-Shan Zou, Yong-Jun Liu, Jingtao Chen(Cat# 140630) were purchased from Sigma-Aldrich. cIAP1-siRNA (Cat# sc-29848) and survivin-siRNA (Cat# sc-29499) were purchased from Santa Cruz. Transfection was performed using Lipofectamine RNAiMAX (Cat# 13778150,

(5) Spatial Gene-Expression Profiling Unveils Immuno-oncogenic Programs of NF1-Associated Peripheral Nerve Sheath Tumor ProgressionClinical Cancer ResearchMarch 1, 2024Dana K. Mitchell, Breanne Burgess, Emily E. White, Abbi E. Smith, Elizabeth A. Sierra Sierra Potchanant, Henry Mang, Brooke E. Hickey, Qingbo Lu, Shaomin Qian, Waylan Bessler, et al.with 10 nM siRNA against CENPF (Santa Cruz Biotechnology, sc-37563), BIRC5 (Santa Cruz Biotechnology, sc-29499) or scrambled control (Santa Cruz Biotechnolgy, sc-37007) using Lipofectamine 3000 transfection reagent

(6) Spatial Gene-Expression Profiling Unveils Immuno-oncogenic Programs of NF1-Associated Peripheral Nerve Sheath Tumor ProgressionClinical cancer research : an official journal of the American Association for Cancer ResearchMarch 1, 2024Mitchell DK, Burgess B, White EE, Smith AE, Sierra Potchanant EA, Mang H, Hickey BE, Lu Q, Qian S, Bessler W, et al.with 10 nM siRNA against CENPF (Santa Cruz Biotechnology, sc-37563), BIRC5 (Santa Cruz Biotechnology, sc-29499) or scrambled control (Santa Cruz Biotechnolgy, sc-37007) using Lipofectamine 3000 transfection reagent

(7) TRAF4 regulates ubiquitination-modulated survivin turnover and confers radioresistanceInternational Journal of Biological SciencesJanuary 1, 2024Jinzhuang Liao, Xiang Qing, Xiaoying Li, Yu Gan, Ruirui Wang, Shuangze Han, Wei Li, Wei SongSanger DNA sequencing as described previously 16, 33. siRNA The siCtrl (sc-37,007), survivin siRNA (sc-29499), XIAP siRNA (sc-37508), and FBXL7 siRNA (sc-62,306) were obtained from Santa Cruz Biotechnology (Dalla,

(8) Hypoxia induces docetaxel resistance in triple-negative breast cancer via the HIF-1α/miR-494/Survivin signaling pathwayNeoplasia (New York, N.Y.)October 1, 2022Li H, Sun X, Li J, Liu W, Pan G, Mao A, Liu J, Zhang Q, Rao L, Xie X, et al.

(9) Epigenetic therapy combination of UNC0638 and CI-994 suppresses breast cancer via epigenetic remodeling of BIRC5 and GADD45ABiomedicine & pharmacotherapy = Biomedecine & pharmacotherapieJanuary 1, 2022Lin HY, Wu HJ, Chen SY, Hou MF, Lin CS, Chu PY.

(10) Localization matters: nuclear-trapped Survivin sensitizes glioblastoma cells to temozolomide by elevating cellular senescence and impairing homologous recombinationCellular and molecular life sciences : CMLSJuly 1, 2021Reich TR, Schwarzenbach C, Vilar JB, Unger S, Mühlhäusler F, Nikolova T, Poplawski A, Baymaz HI, Beli P, Christmann M, et al.RNAs (SignalSilence® Survivin siRNA, Cell Signaling Technology #6351; Survivin siRNA (h), Santa Cruz sc-29499; RAD51 siRNA (h), sc-36361; Origene’s 27-mer RAD51 siRNA) were performed using Lipofectamine RNAiMAX

(11) Generation of reactive oxygen species is the primary mode of action and cause of survivin suppression by sepantronium bromide (YM155)RSC medicinal chemistryApril 28, 2021Wani TH, Chowdhury G, Chakrabarty A.

(12) Targeting survivin sensitizes cervical cancer cells to radiation treatmentBioengineeredDecember 1, 2020Zhou J, Guo X, Chen W, Wang L, Jin Y.

(13) Enhanced Cellular Uptake and Gene Silencing Activity of Survivin-siRNA via Ultrasound-Mediated Nanobubbles in Lung Cancer CellsPharmaceutical researchAugust 5, 2020Akbaba H, Erel-Akbaba G, Kotmakçı M, Başpınar Y.

(14) Targeted gene silencing in vivo by platelet membrane-coated metal-organic framework nanoparticlesScience advancesMarch 1, 2020Zhuang J, Gong H, Zhou J, Zhang Q, Gao W, Fang RH, Zhang L.

(15) MicroRNA-218 enhances gastric cancer cell cisplatin sensitivity by targeting survivinExperimental and therapeutic medicineDecember 1, 2018Zhang Z, Kong Y, Yang W, Zhang B, Ma F, Liu H, Hua Y.small interfering (si)RNA was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA; cat. no. sc‑29499) and the survivin gene knockout assay was performed according to the manufacturer's protocol, untreated

(16) Adaptation to chronic exposure to sepantronium bromide (YM155), a prototypical survivin suppressant is due to persistent DNA damage-response in breast cancer cellsOncotargetSeptember 11, 2018Wani TH, Surendran S, Mishra VS, Chaturvedi J, Chowdhury G, Chakrabarty A.

(17) Role of Survivin and p53 Expression in Response of Primary Culture of Ovarian Cancer Cells to Treatment With Chemotherapeutic AgentsInternational journal of gynecological cancer : official journal of the International Gynecological Cancer SocietyJuly 1, 2018Chawla D, Kar R, Gupta B, Halder S, Garg S, Mehndiratta M, Wadhwa N, Agarwal R.

(18) Glycycoumarin Sensitizes Liver Cancer Cells to ABT-737 by Targeting De Novo Lipogenesis and TOPK-Survivin AxisNutrientsMarch 15, 2018Zhang E, Yin S, Lu X, Ye L, Fan L, Hu H.

(19) miR-494 Sensitizes Gastric Cancer Cells to TRAIL Treatment Through Downregulation of SurvivinCellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacologyJanuary 1, 2018Xu S, Li D, Li T, Qiao L, Li K, Guo L, Liu Y.

(20) Schisandrin B reverses doxorubicin resistance through inhibiting P-glycoprotein and promoting proteasome-mediated degradation of survivinScientific reportsAugust 21, 2017Wang S, Wang A, Shao M, Lin L, Li P, Wang Y.

Be the First to Write a Review!

survivin siRNA (h)

survivin siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (59)

Reviews

survivin siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map