HSP 70 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemHSP 70 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29352
Gene Nameheat shock 70kDa protein 1A
Specieshuman
NCBI Full Gene Nameheat shock protein family A (Hsp70) member 1B, heat shock protein family A (Hsp70) member 1A
NCBI Gene AliasesHSX70, HSPA1, HSP70.2, HSP70-1B, HSP70-1A, HEL-S-103, HSP70I, HSP70.1, HSP70, HSP72, HSP70-1, HSP70-2
TypesiRNA/dsRNA
Quantity10 µM

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Investigating the Potential Role of Capsaicin in Facilitating the Spread of Coxsackievirus B3 via Extracellular VesiclesInternational Journal of Molecular SciencesJanuary 9, 2026Shruti Chatterjee, Ramina Kordbacheh, Haylee Tilley, Devin Briordy, Richard T. Waldron, William D. Cutts, Jayden Aleman, Alexis Cook, Raeesa Dhanji, Lok-Yin Roy Wong, et al.plates and transfected with human HSPA1A-targeting siRNA (Santa Cruz Biotechnology, Dallas, TX, USA; sc-29352) using Effectene Transfection Reagent (Qiagen, Hilden, Germany; 301425). The transfection reagents were

(2) A Role for Periostin Pathological Variants and Their Interaction with HSP70-1a in Promoting Pancreatic Cancer Progression and ChemoresistanceInternational journal of molecular sciencesDecember 8, 2024Tsunetoshi Y, Sanada F, Kanemoto Y, Shibata K, Masamune A, Taniyama Y, Yamamoto K, Morishita R.for 48 h. Control siRNA-A (Cat. #SC-37007, Santa Cruz, Dallas, TX, USA) and HSPA1A siRNA, Human (Cat #SC-29352, Santa Cruz) were used. 4.7. In Situ Hybridization and Single Nucleus RNA-Seq Analysis TMAs obtained

(3) HSP-27 and HSP-70 negatively regulate protective defence responses from macrophages during mycobacterial infectionMicrobes and infectionJuly 1, 2023Saraswati SSK, Rana AK, Singh A, Anang V, Singh A, Natarajan K.

(4) BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1iScienceDecember 22, 2022Hromas R, Srinivasan G, Yang M, Jaiswal A, Totterdale TA, Phillips L, Kirby A, Khodayari N, Brantley M, Williamson EA, et al.

(5) Endothelial HSP72 is not reduced in type 2 diabetes nor is it a key determinant of endothelial insulin sensitivityAmerican journal of physiology. Regulatory, integrative and comparative physiologyJuly 1, 2022Pettit-Mee RJ, Power G, Cabral-Amador FJ, Ramirez-Perez FI, Soares RN, Sharma N, Liu Y, Christou DD, Kanaley JA, Martinez-Lemus LA, et al.

(6) Hyperthermia increases HSP production in human PDMCs by stimulating ROS formation, p38 MAPK and Akt signaling, and increasing HSF1 activityStem cell research & therapyJune 3, 2022Liu JF, Chen PC, Ling TY, Hou CH.

(7) Geranylgeranylacetone promotes human osteosarcoma cell apoptosis by inducing the degradation of PRMT1 through the E3 ubiquitin ligase CHIPJournal of cellular and molecular medicineAugust 1, 2021Jiang L, Liao J, Liu J, Wei Q, Wang Y.(sc‐166963), CHIP (sc‐66803), Ubiquitin (sc‐8017), STAT3 (sc‐8019), p‐STAT3(sc‐8059) and Hsp 70 siRNA (sc‐29352) were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA, USA). Anti‐FAS antibody (ab82419)

(8) Heat shock protein 70 positively regulates transforming growth factor-α-induced hepatocellular carcinoma cell migration via the AKT signaling pathwayHeliyonSeptember 1, 2020Kobayashi K, Matsushima-Nishiwaki R, Yamada N, Migita S, Hioki T, Mizutani D, Kozawa O.

(9) HSP70-eIF4G Interaction Promotes Protein Synthesis and Cell Proliferation in Hepatocellular CarcinomaCancersAugust 13, 2020Wang M, Wei K, Qian B, Feiler S, Lemekhova A, Büchler MW, Hoffmann K.

(10) Hsp70 Is a Potential Therapeutic Target for Echovirus 9 InfectionFrontiers in molecular biosciencesJanuary 1, 2020Wang Y, Zhang H, Ma D, Deng X, Wu D, Li F, Wu Q, Liu H, Wang J.antibody and Goat anti-Rabbit IgG H&L (HRP) were purchased from Abcam (Shanghai, China). HSP 70 siRNA (h) (sc-29352) and Control siRNAs (sc-37007) were purchased from Santa Cruz Biotechnology, Inc. Mice Challenge Experiment

(11) Targeting the interaction of AIMP2-DX2 with HSP70 suppresses cancer developmentNature chemical biologyJanuary 1, 2020Lim S, Cho HY, Kim DG, Roh Y, Son SY, Mushtaq AU, Kim M, Bhattarai D, Sivaraman A, Lee Y, et al.

(12) HSC70 and HSP90 chaperones perform complementary roles in translocation of the cholera toxin A1 subunit from the endoplasmic reticulum to the cytosolThe Journal of biological chemistryAugust 9, 2019Burress H, Kellner A, Guyette J, Tatulian SA, Teter K.

(13) Cell line-specific efficacy of thermoradiotherapy in human and canine cancer cells in vitroPloS oneJanuary 1, 2019Nytko KJ, Thumser-Henner P, Weyland MS, Scheidegger S, Rohrer Bley C.a 6-well plate at density of 100’000 cells/well the day before transfection. siRNA targeting HSP70 (sc-29352) was purchased from Santa Cruz Biotechnology. Control siRNA was purchased from Microsynth AG using the

(14) Heat shock protein 70 and heat shock protein 90 synergistically increase hepatitis B viral capsid assemblyBiochemical and biophysical research communicationsSeptember 18, 2018Seo HW, Seo JP, Jung G.

(15) Inhibition of JAK2/STAT3 Signaling Pathway Suppresses Proliferation of Burkitt's Lymphoma Raji Cells via Cell Cycle Progression, Apoptosis, and Oxidative Stress by Modulating HSP70Medical science monitor : international medical journal of experimental and clinical researchSeptember 8, 2018Xu NW, Chen Y, Liu W, Chen YJ, Fan ZM, Liu M, Li LJ.

(16) Andrographolide induces degradation of mutant p53 via activation of Hsp70International journal of oncologyAugust 1, 2018Sato H, Hiraki M, Namba T, Egawa N, Baba K, Tanaka T, Noshiro H.were obtained from Santa Cruz Biotechnology, Inc. (siControl, cat. no. sc-37007; siHsp70, cat. no. sc-29352) and transfected into cells using Lipofectamine RNAiMax (Invitrogen; Thermo INTERNATIONAL JOURNAL

(17) Stress granules counteract senescence by sequestration of PAI-1EMBO reportsMay 1, 2018Omer A, Patel D, Lian XJ, Sadek J, Di Marco S, Pause A, Gorospe M, Gallouzi IE.(5′‐AUGAGCUUCAAUUGCAUCCTT‐3′; siRNA ID # s18158). siRNA specific for HSP70 was obtained from Santa Cruz Biotechnology (sc‐29352). Control siRNA was from Dharmacon (5′‐AAGCCAAUUCAUCAGCAAUGG‐3′). Plasmid Plasmid containing full‐length

(18) Modulation of adenylate cyclase signaling in association with MKK3/6 stabilization under combination of SAC and berberine to reduce HepG2 cell survivabilityApoptosis : an international journal on programmed cell deathNovember 1, 2017Sengupta D, Chowdhury KD, Chatterjee S, Sarkar A, Paul S, Sur PK, Sadhukhan GC.

(19) BAG5 Interacts with DJ-1 and Inhibits the Neuroprotective Effects of DJ-1 to Combat Mitochondrial Oxidative DamageOxidative Medicine and Cellular LongevityMarch 2, 2017Li-xia Qin et al.sequencing. The siRNA-Hsp70 duplex and scrambled siRNA were purchased from Santa Cruz Biotechnology (sc-29352). 2.2. Antibodies and Reagents. The antibodies against different tags and proteins used for immunoprecipitation

(20) High Estradiol Concentrations Induce Heat Shock Protein 70 Expression and Suppress Nuclear Factor Kappa B Activation in Human Endometrial Epithelial CellsBiology of reproductionOctober 1, 2016Chen CD, Chen SU, Chou CH, Chen MJ, Wen WF, Wu SY, Yang YS, Yang JH.

Be the First to Write a Review!

HSP 70 siRNA (h)

HSP 70 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (45)

Reviews

HSP 70 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map