dsg3 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
Itemdsg3 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-43115
Quantity10 µM
TypesiRNA/dsRNA
NCBI Gene AliasesABOLM, CDHF6, PVA
NCBI Full Gene Namedesmoglein 3
Specieshuman
Gene Namedesmoglein 3

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Tumor Invasive Border Index ( TIBI ) in colorectal cancer: linking infiltrative morphology to molecular insightsThe Journal of PathologyJune 18, 2026Akseli Kehusmaa, Jouni Härkönen, Huayi Li, Päivi Sirniö, Ville K Äijälä, Henna Karjalainen, Meeri Kastinen, Vilja V Tapiainen, Tuomo Mantere, Vesa‐Matti Pohjanen, et al.5′‐CGGAUACAAUGUGACGUACUGGAGG‐3′). For DSG3 knockdown, we used a siRNA pool with three specific oligos (sc‐43115, Santa Cruz Biotechnology, Dallas, TX, USA). For invasion assay, 5 × 104 cells were seeded onto Matrigel‐coated

(2) Up-regulation of ST18 in pemphigus vulgaris drives a self-amplifying p53-dependent pathomechanism resulting in decreased desmoglein 3 expressionScientific reportsJanuary 1, 0001"Assaf S, Vodo D, Malovitski K, Mohamad J, Bergson S, Feller Y, Malki L, Sarig O, Sprecher E."co-transfection of the cells with a DSG3-specific siRNA (Santa Cruz Biotechnology, Santa Cruz, CA, SC-43115). Efficiency of gene knock down was assessed by qRT-PCR (Supplementary Fig. 3). ST18 promoter luciferase reporter assay

Be the First to Write a Review!

dsg3 siRNA (h)

dsg3 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (2)

Reviews

dsg3 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map