karyopherin β2 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
Itemkaryopherin β2 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-35737
Gene Nametransportin 1
Quantity10 µM
Specieshuman
NCBI Full Gene Nametransportin 1
NCBI Gene AliasesIPO2, KPNB2, MIP, MIP1, TRN
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Transportin 1 is a major nuclear import receptor of the nitric oxide synthase interacting proteinThe Journal of biological chemistryMarch 1, 2023Pörschke M, Rodríguez-González I, Parfentev I, Urlaub H, Kehlenbach RH.seeded in 24-well plates, transfected with 50 nM siRNA pool against TNPO1 (Santa Cruz Biotechnology Inc, sc-35737) or the independent siRNAs (GCAAAGAUGUACUCGUAAG [siRNA A] and GUAUAGAGAUGCAGCCUUA [siRNA B]; obtained

(2) Nup358 and Transportin 1 Cooperate in Adenoviral Genome ImportJournal of virologyMay 4, 2020Carlon-Andres I, Lagadec F, Pied N, Rayne F, Lafon ME, Kehlenbach RH, Wodrich H.obtained from Euroﬁns Genomics. siRNAs for the depletion of transportin were obtained from Santa Cruz (sc-35737) (32). Efﬁcient depletion of both Nup358 and transportin 1 was monitored by immunoﬂuorescence and reached

(3) Graphene oxide sensitizes cancer cells to chemotherapeutics by inducing early autophagy events, promoting nuclear trafficking and necrosisTheranosticsJanuary 1, 2018Lin KC, Lin MW, Hsu MN, Yu-Chen G, Chao YC, Tuan HY, Chiang CS, Hu YC.

(4) Importin 7 and Nup358 promote nuclear import of the protein component of human telomerasePloS oneJanuary 1, 2014Frohnert C, Hutten S, Wälde S, Nath A, Kehlenbach RH.NM_002265; Nup358, CACAGACAAAGCCGUUGAAUU, NM_006267; transportin, pool of three specific siRNAs, Santa Cruz, Sc-35737, NM_002270.3; non-targeting, GAGCUUCAACUAACAGGAATT) at a final concentration of 100 nM, using Oligofectamine

(5) Cysteine (C)-x-C receptor 4 undergoes transportin 1-dependent nuclear localization and remains functional at the nucleus of metastatic prostate cancer cellsPloS oneJanuary 1, 2013Don-Salu-Hewage AS, Chan SY, McAndrews KM, Chetram MA, Dawson MR, Bethea DA, Hinton CV.(sc-9996), Protein A/G Plus-Agarose beads (SC-2003), anti-Karyopherinb2 (SC-166127), Karyopherinb2 siRNA (h) (SC-35737) and DAPI (SC-3598) were from Santa Cruz Biotech. NE-PER Nuclear and Cytoplasmic Extraction Kit (78833),

(6) Heterodimerization with Jun family members regulates c-Fos nucleocytoplasmic trafficThe Journal of biological chemistryOctober 19, 2007Malnou CE, Salem T, Brockly F, Wodrich H, Piechaczyk M, Jariel-Encontre I.

Be the First to Write a Review!