IFITM1 siRNA (h) from Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

(1) P53 Status Influences the Anti-proliferative Effect Induced by IFITM1 Inhibition in Estrogen Receptor-positive Breast Cancer CellsCancer Genomics - ProteomicsSeptember 1, 2024DER SHENG SUN, JUNG-SOOK YOON, YONG-SEOK KIM, HYE SUNG WONMCF-7 and TamR were transiently transfected with p53 siRNA (#sc-29435, Santa Cruz), IFITM1 siRNA (#sc-44549, Santa Cruz), and negative control siRNA (#sc-37007, Santa Cruz) using the Lipofectamine® RNAiMAX reagent

(2) Disrupting interferon-alpha and NF-kappaB crosstalk suppresses IFITM1 expression attenuating triple-negative breast cancer progressionCancer lettersAugust 28, 2021Provance OK, Geanes ES, Lui AJ, Roy A, Holloran SM, Gunewardena S, Hagan CR, Weir S, Lewis-Wambi J.transfected with pooled small-interfering RNAs (siRNAs) targeting IFITM1 (Santa Cruz Biotechnology: sc-44549) which has been validated previously (14). siCon and siIFITM1 cells were then used for functional in vitro

(3) Upregulation of PITX2 Promotes Letrozole Resistance Via Transcriptional Activation of IFITM1 Signaling in Breast Cancer CellsCancer research and treatment : official journal of Korean Cancer AssociationApril 1, 2019Xu YY, Yu HR, Sun JY, Zhao Z, Li S, Zhang XF, Liao ZX, Cui MK, Li J, Li C, et al.

(6) Interferon-induced transmembrane protein 1 (IFITM1) overexpression enhances the aggressive phenotype of SUM149 inflammatory breast cancer cells in a signal transducer and activator of transcription 2 (STAT2)-dependent mannerBreast cancer research : BCRFebruary 20, 2016Ogony J, Choi HJ, Lui A, Cristofanilli M, Lewis-Wambi J.Santa Cruz Biotechnology. The IFITM1 shRNA plasmid was a pool of three different shRNA plasmids: SHA, SHB, and SHC. sc-44549-SHA: hairpin sequence: GATCCCACACTTCTCAAACCTTCATTCAAG AGATGAAGGTTTGAGAAGTGTGTTTTT; corresponding siRNA

(7) Targeting interferon response genes sensitizes aromatase inhibitor resistant breast cancer cells to estrogen-induced cell deathBreast cancer research : BCRJanuary 15, 2015Choi HJ, Lui A, Ogony J, Jan R, Sims PJ, Lewis-Wambi J.(siBax), Noxa-siRNA (h) (siNoxa), or nontarget siRNA (siCon). The siPLSCR1 (cat# sc-44028), siIFITM1 (cat# sc-44549), siSTAT1 (cat# sc-44123), siSTAT2 (cat# sc-29492), siIFNα (cat# sc-63324), siIRF-7 (cat# 38011) and

(8) Blocking the PI3K/AKT pathway enhances mammalian reovirus replication by repressing IFN-stimulated genesFrontiers in microbiologyJanuary 1, 2015Tian J, Zhang X, Wu H, Liu C, Li Z, Hu X, Su S, Wang LF, Qu L.

IFITM1 siRNA (h)