Rab 7 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemRab 7 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29460
Gene NameRAB7A, member RAS oncogene family
Quantity10 µM
Specieshuman
NCBI Full Gene NameRAB7A, member RAS oncogene family
NCBI Gene AliasesCMT2B, PRO2706, RAB7
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Light-activated mitochondrial fission through optogenetic control of mitochondria-lysosome contactsNature communicationsJuly 25, 2022Qiu K, Zou W, Fang H, Hao M, Mehta K, Tian Z, Guan JL, Zhang K, Huang T, Diao J.primer ccaccggtcgccaccgcagtgagcaagggcga were purchased from Integrated DNA technologies. RAB7 siRNA (h, sc-29460) and the antibody RAB7 (mouse, B-3, #sc-376362, 1:1000) were purchased from Santa Cruz Biotechnology Inc

(2) Porcine Circovirus Type 3 Enters Into PK15 Cells Through Clathrin- and Dynamin-2-Mediated Endocytosis in a Rab5/Rab7 and pH-Dependent FashionFrontiers in microbiologyJanuary 1, 2021Shi R, Hou L, Wei L, Quan R, Zhou B, Jiang H, Wang J, Zhu S, Song J, Wang D, et al.targeting CLTC (siCLTC, sc-35067), caveolin-1 (siCav1, sc-29241), Rab5 (siRab5, sc-36344), Rab7 (siRab7, sc-29460), and siRNA with a control sequence (siCtrl, sc-37007) were purchased from Santa Cruz Biotechnology.

(3) KSHV dysregulates bulk macroautophagy, mitophagy and UPR to promote endothelial to mesenchymal transition and CCL2 release, key events in viral-driven sarcomagenesisInternational journal of cancerDecember 15, 2020Santarelli R, Arteni AMB, Gilardini Montani MS, Romeo MA, Gaeta A, Gonnella R, Faggioni A, Cirone M.interfering RNA (siRNA) HUVEC cells were transfected with a specific RAB7 siRNA (Santa Cruz Biotechnology, sc29460) by using INTERFERin transfection reagent (Polyplus transfection, 409-01) according to the manufacturer's

(4) Characterization of Zika Virus Endocytic Pathways in Human Glioblastoma CellsFrontiers in microbiologyJanuary 1, 2020Li M, Zhang D, Li C, Zheng Z, Fu M, Ni F, Liu Y, Du T, Wang H, Griffin GE, et al.siRNAs targeting vacuolar ATPase (VTPase, sc-42686), dynamin (sc-43736), Rab5 (sc-36344), and Rab7 (sc-29460), respectively, were purchased from Santa Cruz. T98G cells were transfected with the indicated siRNAs

(5) Porcine sapovirus Cowden strain enters LLC-PK cells via clathrin- and cholesterol-dependent endocytosis with the requirement of dynamin IIVeterinary researchSeptember 17, 2018Soliman M, Kim DS, Kim C, Seo JY, Kim JY, Park JG, Alfajaro MM, Baek YB, Cho EH, Park SI, et al.

(6) Rab5, Rab7, and Rab11 Are Required for Caveola-Dependent Endocytosis of Classical Swine Fever Virus in Porcine Alveolar MacrophagesJournal of virologyAugust 1, 2018Zhang YN, Liu YY, Xiao FC, Liu CC, Liang XD, Chen J, Zhou J, Baloch AS, Kan L, Zhou B, et al.

(7) Rab5 and Rab11 Are Required for Clathrin-Dependent Endocytosis of Japanese Encephalitis Virus in BHK-21 CellsJournal of virologyOctober 1, 2017Liu CC, Zhang YN, Li ZY, Hou JX, Zhou J, Kan L, Zhou B, Chen PY.clathrin heavy chain (sc-35067), caveolin-1 (sc-29241), V-ATPase B1 (sc-36787), siRab5 (sc-36344), siRab7 (sc-29460), siRab9 (sc-44065), the negative-control siRNA (sc-37007) (all, Santa Cruz Biotechnology), and siRab11 (317644A10;

(8) Entry of Classical Swine Fever Virus into PK-15 Cells via a pH-, Dynamin-, and Cholesterol-Dependent, Clathrin-Mediated Endocytic Pathway That Requires Rab5 and Rab7Journal of virologyOctober 15, 2016Shi BJ, Liu CC, Zhou J, Wang SQ, Gao ZC, Zhang XM, Zhou B, Chen PY.(CACACAGUUUCGAUGGCAUC UTT) for caveolin-1 (38); siRNA for Rab5 (siRab5) (catalog number sc36344), siRab7 (catalog number sc-29460), and the negative control (catalog number sc-37007) were obtained from Santa Cruz Biotechnology. At 48

(9) The activation of KSHV lytic cycle blocks autophagy in PEL cellsAutophagyNovember 2, 2015Granato M, Santarelli R, Filardi M, Gonnella R, Farina A, Torrisi MR, Faggioni A, Cirone M.RNA The knockdown of BECN1 (Santa Cruz Biotechnology, sc-29797) or RAB7 (Santa Cruz Biotechnology, sc-29460) was performed in PEL cell lines using specific small interfering RNA duplex. The day before transfection,

(10) Echovirus 1 entry into polarized Caco-2 cells depends on dynamin, cholesterol, and cellular factors associated with macropinocytosisJournal of virologyAugust 1, 2013Krieger SE, Kim C, Zhang L, Marjomaki V, Bergelson JM.CCA CGC CAG U-3=) were synthesized based on sequences reported in Amstutz et al. (18). Rab7 siRNA (sc-29460) was purchased from Santa Cruz. Control siRNA has been described previously (19). Cells were transfected

(11) Echovirus 7 entry into polarized intestinal epithelial cells requires clathrin and Rab7MBioJanuary 1, 2012Kim C, Bergelson JM.UGA ACG AAA UTT 3=]) were synthesized based on sequences in a previous report (51), and Rab7 siRNA (sc-29460) was purchased from Santa Cruz. SiRNAs targeting Rab5 and Rab7 were used at a 20 nM concentration; other

(12) Pichindé virus is trafficked through a dynamin 2 endocytic pathway that is dependent on cellular Rab5- and Rab7-mediated endosomesArchives of virologyJanuary 1, 2008Vela EM, Colpitts TM, Zhang L, Davey RA, Aronson JF.

(13) Coxsackievirus entry across epithelial tight junctions requires occludin and the small GTPases Rab34 and Rab5Cell host & microbeSeptember 13, 2007Coyne CB, Shen L, Turner JR, Bergelson JM.Author Manuscript Rab13 SMARTpool siRNA reagent was obtained from Dharmacon (Chicago, IL). Rab7 siRNA (sc-29460) was purchased from Santa Cruz Biotechnology. Double-stranded siRNAs targeted against human claudin-1

(14) rAAV2 traffics through both the late and the recycling endosomes in a dose-dependent fashionMolecular therapy : the journal of the American Society of Gene TherapyApril 1, 2006Ding W, Zhang LN, Yeaman C, Engelhardt JF.

Be the First to Write a Review!

Rab 7 siRNA (h)

Rab 7 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (14)

Reviews

Rab 7 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map