Rab 5A siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemRab 5A siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-36344
Gene NameRAB5A, member RAS oncogene family
Quantity10 µM
Specieshuman
NCBI Full Gene NameRAB5A, member RAS oncogene family
NCBI Gene AliasesRAB5
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Nicotinamide mononucleotide protects against diabetic nephropathy via IL-6/Rab5-mediated crosstalk between proximal tubular epithelial cells and podocytesWorld J DiabetesOctober 15, 2025Dong-Qing Zha, Ping Gao, Xiao-Yan Wuanti-nephrin monoclonal antibody (mAb; sc-376522), mouse anti-β-actin mAb (sc-47778), and Rab5 siRNA (sc-36344) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, United States). Mouse anti-Rab5-GTP mAb

(2) Endosomes serve as signaling platforms for RIG-I ubiquitination and activationScience advancesNovember 8, 2024Chen KR, Yang CY, Shu SG, Lo YC, Lee KW, Wang LC, Chen JB, Shih MC, Chang HC, Hsiao YJ, et al.(5′-AGGAAUCAGUGUUGUAGUA-3′), siRab7 (5′-GGAUGACCUCUAGGAAGAA-3′), and siLamp1 (5′-AGAAAUGCAACACGUUA-3′). Rab5 siRNA pool (sc-36344) was purchased from Santa Cruz Biotechnology. siTAPE-2 was purchased from Dharmacon. HEK293 cells seeded

(3) NOTCH-induced rerouting of endosomal trafficking disables regulatory T cells in vasculitisThe Journal of clinical investigationJanuary 4, 2021Jin K, Wen Z, Wu B, Zhang H, Qiu J, Wang Y, Warrington KJ, Berry GJ, Goronzy JJ, Weyand CM.

(4) Porcine Circovirus Type 3 Enters Into PK15 Cells Through Clathrin- and Dynamin-2-Mediated Endocytosis in a Rab5/Rab7 and pH-Dependent FashionFrontiers in microbiologyJanuary 1, 2021Shi R, Hou L, Wei L, Quan R, Zhou B, Jiang H, Wang J, Zhu S, Song J, Wang D, et al.instructions. The siRNAs targeting CLTC (siCLTC, sc-35067), caveolin-1 (siCav1, sc-29241), Rab5 (siRab5, sc-36344), Rab7 (siRab7, sc-29460), and siRNA with a control sequence (siCtrl, sc-37007) were purchased from

(5) Characterization of Zika Virus Endocytic Pathways in Human Glioblastoma CellsFrontiers in microbiologyJanuary 1, 2020Li M, Zhang D, Li C, Zheng Z, Fu M, Ni F, Liu Y, Du T, Wang H, Griffin GE, et al.(Masuyama et al., 2009). The siRNAs targeting vacuolar ATPase (VTPase, sc-42686), dynamin (sc-43736), Rab5 (sc-36344), and Rab7 (sc-29460), respectively, were purchased from Santa Cruz. T98G cells were transfected with

(6) Porcine sapovirus Cowden strain enters LLC-PK cells via clathrin- and cholesterol-dependent endocytosis with the requirement of dynamin IIVeterinary researchSeptember 17, 2018Soliman M, Kim DS, Kim C, Seo JY, Kim JY, Park JG, Alfajaro MM, Baek YB, Cho EH, Park SI, et al.

(7) Rab5, Rab7, and Rab11 Are Required for Caveola-Dependent Endocytosis of Classical Swine Fever Virus in Porcine Alveolar MacrophagesJournal of virologyAugust 1, 2018Zhang YN, Liu YY, Xiao FC, Liu CC, Liang XD, Chen J, Zhou J, Baloch AS, Kan L, Zhou B, et al.

(8) Rab5 and Rab11 Are Required for Clathrin-Dependent Endocytosis of Japanese Encephalitis Virus in BHK-21 CellsJournal of virologyOctober 1, 2017Liu CC, Zhang YN, Li ZY, Hou JX, Zhou J, Kan L, Zhou B, Chen PY.as follows: clathrin heavy chain (sc-35067), caveolin-1 (sc-29241), V-ATPase B1 (sc-36787), siRab5 (sc-36344), siRab7 (sc-29460), siRab9 (sc-44065), the negative-control siRNA (sc-37007) (all, Santa Cruz Biotechnology),

(9) Entry of Classical Swine Fever Virus into PK-15 Cells via a pH-, Dynamin-, and Cholesterol-Dependent, Clathrin-Mediated Endocytic Pathway That Requires Rab5 and Rab7Journal of virologyOctober 15, 2016Shi BJ, Liu CC, Zhou J, Wang SQ, Gao ZC, Zhang XM, Zhou B, Chen PY.(37) and siCav (CACACAGUUUCGAUGGCAUC UTT) for caveolin-1 (38); siRNA for Rab5 (siRab5) (catalog number sc36344), siRab7 (catalog number sc-29460), and the negative control (catalog number sc-37007) were obtained

(10) Shear stress activates extracellular signal-regulated kinase 1/2 via the angiotensin II type 1 receptorFASEB journal : official publication of the Federation of American Societies for Experimental BiologyAugust 1, 2013Ramkhelawon B, Rivas D, Lehoux S.

Be the First to Write a Review!

Rab 5A siRNA (h)

Rab 5A siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (10)

Reviews

Rab 5A siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map