IL-8RB siRNA (h) from Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

(1) CXCR2 Ligands and mTOR Activation Enhance Reprogramming of Human Somatic Cells to Pluripotent Stem CellsStem cells and developmentFebruary 1, 2020Lee SJ, Kang KW, Kim JH, Lee BH, Jung JH, Park Y, Hong SC, Kim BS.

(3) CXCL8 derived from tumor-associated macrophages and esophageal squamous cell carcinomas contributes to tumor progression by promoting migration and invasion of cancer cellsOncotargetDecember 1, 2017Hosono M, Koma YI, Takase N, Urakawa N, Higashino N, Suemune K, Kodaira H, Nishio M, Shigeoka M, Kakeji Y, et al.interfering RNA (siRNA) targeting human CXCR1 (IL-8RA siRNA, sc-40026, Santa Cruz) and CXCR2 (IL-8RB siRNA, sc-40028, Santa Cruz) using Lipofectamine® RNAiMAX (Invitrogen). Control siRNA (Sigma-Aldrich) was used as the

(4) CXCR2 Inhibition in Human Pluripotent Stem Cells Induces Predominant Differentiation to Mesoderm and Endoderm Through Repression of mTOR, β-Catenin, and hTERT ActivitiesStem cells and developmentJuly 1, 2016Jung JH, Kang KW, Kim J, Hong SC, Park Y, Kim BS.Santa Cruz Biotechnology).The shRNA lentiviral particles were a pool of three different shRNA plasmids: sc-40028-VA, hairpin sequence: GATCCGTCTACTCATCCAATGTTAT TCAAGAGATAACATTGGATGAGTAGACTTTTT, corresponding siRNA

(5) CXCL1 inhibits airway smooth muscle cell migration through the decoy receptor Duffy antigen receptor for chemokinesJournal of immunology (Baltimore, Md. : 1950)August 1, 2014Al-Alwan LA, Chang Y, Rousseau S, Martin JG, Eidelman DH, Hamid Q.

(6) Differential roles of CXCL2 and CXCL3 and their receptors in regulating normal and asthmatic airway smooth muscle cell migrationJournal of immunology (Baltimore, Md. : 1950)September 1, 2013Al-Alwan LA, Chang Y, Mogas A, Halayko AJ, Baglole CJ, Martin JG, Rousseau S, Eidelman DH, Hamid Q.

IL-8RB siRNA (h)