PKR siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemPKR siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-36263
Gene Nameeukaryotic translation initiation factor 2-alpha kinase 2
Quantity10 µM
Specieshuman
NCBI Full Gene Nameeukaryotic translation initiation factor 2 alpha kinase 2
NCBI Gene AliasesDYT33, EIF2AK1, LEUDEN, PKR, PPP1R83, PRKR
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) SINE RNA of the imprinted miRNA clusters mediates constitutive type III interferon expression and antiviral protection in hemochorial placentasCell host & microbeJuly 12, 2023Wickramage I, VanWye J, Max K, Lockhart JH, Hortu I, Mong EF, Canfield J, Lamabadu Warnakulasuriya Patabendige HM, Guzeloglu-Kayisli O, Inoue K, et al.MAVS siRNA (h) (Santa Cruz Biotechnology, Inc; sc-75755), PKR siRNA (h) (Santa Cruz Biotechnology, Inc; sc-36263), or Control siRNA-A (Santa Cruz Biotechnology, Inc; sc-37007). For TLR3 (human) Silencer Select Validated siRNA

(2) Cytoplasmic proteotoxicity regulates HRI-dependent phosphorylation of eIF2α via the Hsp70-Bag3 moduleiScienceMay 20, 2022Patel S, Kumar S, Baldan S, Hesin A, Yaglom J, Sherman MY.(D-011957-01), GCN2 (D-016634-02), DDIT3 (M-017609-01), HRI (M-006968-00) , siPERK (sc-36213) and siPKR (sc-36263) from Santa Cruz, see also Table S3. Real time PCR analysis Total RNA was isolated from cells using

(3) Salidroside induces cell apoptosis and inhibits the invasiveness of HT29 colorectal cells by regulating protein kinase R, NF-κB and STAT3Cancer biomarkers : section A of Disease markersJanuary 1, 2021El-Kott AF, ElBealy ER, Alshehri AS, El-Kenawy AE, Khalifa HS, AlRamlawy AM.

(4) Synergistic activation of p53 by actinomycin D and nutlin-3a is associated with the upregulation of crucial regulators and effectors of innate immunityCellular signallingMay 1, 2020Krześniak M, Zajkowicz A, Gdowicz-Kłosok A, Głowala-Kosińska M, Łasut-Szyszka B, Rusin M.

(5) DDX39B interacts with the pattern recognition receptor pathway to inhibit NF-κB and sensitize to alkylating chemotherapyBMC biologyMarch 24, 2020Szymura SJ, Bernal GM, Wu L, Zhang Z, Crawley CD, Voce DJ, Campbell PA, Ranoa DE, Weichselbaum RR, Yamini B.siRNA#3 (Dharmacon), siGENOME Smartpool si-LGP2 (Dharmacon), si-TLR3 (sc-36685, Santa Cruz), and si-PKR (sc-36263, Santa Cruz). Plasmid, lentivirus, and CRISPR clone generation Flag-tagged DDX39B was obtained by

(6) Puumala and Andes Orthohantaviruses Cause Transient Protein Kinase R-Dependent Formation of Stress GranulesJournal of virologyJanuary 17, 2020Christ W, Tynell J, Klingström J.done with ImageJ version 1.48 software. siRNA transfection. Transfection of PKR siRNA (Santa Cruz, sc-36263) or control scramble siRNA (Santa Cruz, sc-37007) was performed using siRNA transfection medium (Santa Cruz

(7) Suhuang antitussive capsule inhibits NLRP3 inflammasome activation and ameliorates pulmonary dysfunction via suppression of endoplasmic reticulum stress in cough variant asthmaBiomedicine & pharmacotherapy = Biomedecine & pharmacotherapieOctober 1, 2019Qin W, Wu X, Jia Y, Tong X, Guo C, Chen D, Wang Z, Tan N.

(8) Regulation of the unfolded protein response through ATF4 and FAM129A in prostate cancerOncogeneAugust 1, 2019Pällmann N, Livgård M, Tesikova M, Zeynep Nenseth H, Akkus E, Sikkeland J, Jin Y, Koc D, Kuzu OF, Pradhan M, et al.siRNA siATF4-1 Dharmacon L-005125 CAGATTGGATGTTGGAGAA, CGACTTGGATGCCCTGTTG, GAAGAACGAGGCTCTAAAA, GAGATAGGAAGCCAGACTA siATF4-2 Qiagen SI03019345 CAGCGTTGCTGTAACCGACAA siCEBPB Qiagen SI02777292 CGGGCCCTGAGTAATCGCTTA SI03058062 CACCCTGCGGAACTTGTTCAA SI03022341 TTCCGTTTCAAGCATTAAGAA SI00073640 CCCGTGGTGTTATTTAAAGAA siFAM-1 Qiagen SI04167219 CACGTGCGCACTGAAGTAGAA siFAM-2 Qiagen - AGAGATTTAACGTCACAGTTT siPKR Santa Cruz sc-36263 N/A siPERK Santa Cruz sc-36213 N/A siGCN2 Santa Cruz sc-45644 N/A Quantitative PCR mRNA expression

(9) Oncolytic virus immunotherapy induces immunogenic cell death and overcomes STING deficiency in melanomaOncoimmunologyJanuary 1, 2019Bommareddy PK, Zloza A, Rabkin SD, Kaufman HL.

(10) Role of PKR in the Inhibition of Proliferation and Translation by Polycystin-1BioMed research internationalJanuary 1, 2019Tang Y, Shi G, Yang J, Zheng W, Tang J, Chen XZ, Yang J, Wang Z.2000 reagent (Invitrogen). 2.3. Gene Knockdown. Small Interfering RNAs (siRNA) of PKR (Santa Cruz, Cat#sc-36263) was utilized to interfere with HEK293T and HeLa cells according product description. HEK293T or HeLa cells

(11) HIV-1 Tat phosphorylation on Ser-16 residue modulates HIV-1 transcriptionRetrovirologyMay 23, 2018Ivanov A, Lin X, Ammosova T, Ilatovskiy AV, Kumari N, Lassiter H, Afangbedji N, Niu X, Petukhov MG, Nekhai S.

(12) PKR activation causes inflammation and MMP-13 secretion in human degenerated articular chondrocytesRedox biologyApril 1, 2018Ma CH, Wu CH, Jou IM, Tu YK, Hung CH, Hsieh PL, Tsai KL.

(13) Kisspeptin inhibits cancer growth and metastasis via activation of EIF2AK2Molecular medicine reportsNovember 1, 2017Kim TH, Cho SG.

(14) ISG15 Modulates Type I Interferon Signaling and the Antiviral Response during Hepatitis E Virus ReplicationJournal of virologyOctober 1, 2017Sooryanarain H, Rogers AJ, Cao D, Haac MER, Karpe YA, Meng XJ.

(15) Polycystin-1 inhibits eIF2α phosphorylation and cell apoptosis through a PKR-eIF2α pathwayScientific reportsSeptember 13, 2017Tang Y, Wang Z, Yang J, Zheng W, Chen D, Wu G, Sandford R, Tang J, Chen XZ.-polyacrylamide gel electrophoresis (SDS-PAGE) for immunoblotting. Gene knockdown by siRNA PKR siRNA (Santa Cruz, Cat#sc-36263) was used to transfect HEK293T cells using Lipofectamine 2000 reagent following the manufacturer’s instructions.

(16) Imiquimod-induced autophagy is regulated by ER stress-mediated PKR activation in cancer cellsJournal of dermatological scienceAugust 1, 2017Chang SH, Huang SW, Wang ST, Chung KC, Hsieh CW, Kao JK, Chen YJ, Wu CY, Shieh JJ.

(17) Smad7 knockdown activates protein kinase RNA-associated eIF2α pathway leading to colon cancer cell deathCell death & diseaseMarch 16, 2017De Simone V, Bevivino G, Sedda S, Izzo R, Laudisi F, Dinallo V, Franzè E, Colantoni A, Ortenzi A, Salvatori S, et al.

(18) 2'Fluoro Modification Differentially Modulates the Ability of RNAs to Activate Pattern Recognition ReceptorsNucleic acid therapeuticsJune 1, 2016Lee Y, Urban JH, Xu L, Sullenger BA, Lee J.

(19) Malonate induces the assembly of cytoplasmic stress granulesFEBS lettersJanuary 1, 2016Fu X, Gao X, Ge L, Cui X, Su C, Yang W, Sun X, Zhang W, Yao Z, Yang X, et al.

(20) Involvement of general control nonderepressible kinase 2 in cancer cell apoptosis by posttranslational mechanismsMolecular biology of the cellMarch 15, 2015Wei C, Lin M, Jinjun B, Su F, Dan C, Yan C, Jie Y, Jin Z, Zi-Chun H, Wu Y.Genepharma (Shanghai, China). GCN2 siRNA (h) (sc-45644), PERK siRNA (h) (sc-36213), PKR siRNA (h) (sc-36263), and CHOP siRNA (h) (sc-35437) were purchased from Santa Cruz Biotechnology. These siRNA products consist

Be the First to Write a Review!

PKR siRNA (h)

PKR siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (32)

Reviews

PKR siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map