DJ-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemDJ-1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-37080
Gene NameParkinson disease (autosomal recessive, early onset) 7
Quantity10 µM
Specieshuman
NCBI Full Gene NameParkinsonism associated deglycase
NCBI Gene AliasesDJ-1, DJ1, GATD2, HEL-S-67p
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) DJ-1 is an essential downstream mediator in PINK1/parkin-dependent mitophagyBrain : a journal of neurologyDecember 19, 2022Imberechts D, Kinnart I, Wauters F, Terbeek J, Manders L, Wierda K, Eggermont K, Madeiro RF, Sue C, Verfaillie C, et al.CGGCCGGGAATTCGTCGACTGATGGTGGGTCGGAACAGCGCCATCGCCGCCGGTGTATGCGGGGCCCTTTTCATTGGGTACTGCATCTACTTCGACCGCAAAAGACGAAGTGACCCCAACTTCAAGAACAGGCTTCGAGAACGAAGAAAGAAACAGAAGCTTGCCAAGGGTGGTGGAGGCAGTGGAGGTGGAGGAAGCGGAGGTGGTGGCAGCATCGCCATGGCTTCCAAAAGAGC. DJ-1 siRNA1 was from Santa Cruz (sc-37080) and is a pool of three siRNAs with the following target sequences: 5′-CTCCACTTGTTCTTAAAGA-3′, 5′-CGACGATCACTTAGAGAAA-3′

(2) Oncoprotein DJ-1 interacts with mTOR complexes to effect transcription factor Hif1α-dependent expression of collagen I (α2) during renal fibrosisThe Journal of biological chemistrySeptember 1, 2022Das F, Ghosh-Choudhury N, Maity S, Kasinath BS, Choudhury GG.

(3) Protective role of DJ-1 in endotoxin-induced acute kidney injuryAmerican journal of physiology. Renal physiologyOctober 1, 2020Leeds J, Scindia Y, Loi V, Wlazlo E, Ghias E, Cechova S, Portilla D, Ledesma J, Swaminathan S.

(4) DJ-1 modulates the unfolded protein response and cell death via upregulation of ATF4 following ER stressCell death & diseaseFebruary 12, 2019Yang J, Kim KS, Iyirhiaro GO, Marcogliese PC, Callaghan SM, Qu D, Kim WJ, Slack RS, Park DS.

(5) Effect of DJ-1 Downregulation on the Functions of the First Trimester Extravillous TrophoblastsReproductive sciences (Thousand Oaks, Calif.)September 1, 2018Kwon HS, Park JH, Hwang HS, Sohn IS, Kim YH, Cho S.

(6) PARK7 modulates autophagic proteolysis through binding to the N-terminally arginylated form of the molecular chaperone HSPA5AutophagyJanuary 1, 2018Lee DH, Kim D, Kim ST, Jeong S, Kim JL, Shim SM, Heo AJ, Song X, Guo ZS, Bartlett DL, et al.

(7) Salidroside Protects against MPP+-Induced Neuronal Injury through DJ-1-Nrf2 Antioxidant PathwayEvidence-based complementary and alternative medicine : eCAMJanuary 1, 2017Wu L, Xu H, Cao L, Li T, Li R, Feng Y, Chen J, Ma J.

(8) Cardioprotective effects of Cu((II))ATSM in human vascular smooth muscle cells and cardiomyocytes mediated by Nrf2 and DJ-1Scientific reportsDecember 21, 2016Srivastava S, Blower PJ, Aubdool AA, Hider RC, Mann GE, Siow RC.

(9) Targeted knockdown of DJ-1 induces multiple myeloma cell death via KLF6 upregulationApoptosis : an international journal on programmed cell deathDecember 1, 2016Raninga PV, Di Trapani G, Vuckovic S, Tonissen KF.

(10) DJ-1 upregulates breast cancer cell invasion by repressing KLF17 expressionBritish journal of cancerMarch 4, 2014Ismail IA, Kang HS, Lee HJ, Kim JK, Hong SH.

(11) Decline in DJ-1 and decreased nuclear translocation of Nrf2 in Fuchs endothelial corneal dystrophyInvestigative ophthalmology & visual scienceAugust 24, 2012Bitar MS, Liu C, Ziaei A, Chen Y, Schmedt T, Jurkunas UV.

(12) Increased interaction between DJ-1 and the Mi-2/ nucleosome remodelling and deacetylase complex during cellular stressProteomicsApril 1, 2010Opsahl JA, Hjørnevik LV, Bull VH, Fismen L, Frøyset AK, Gromyko D, Solstad T, Fladmark KE.

Be the First to Write a Review!

DJ-1 siRNA (h)

DJ-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (12)

Reviews

DJ-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map