Sp1 siRNA (h2) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemSp1 siRNA (h2)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-44221
Gene NameSp1 transcription factor
Quantity10 µM
Specieshuman
NCBI Full Gene Nametrans-acting transcription factor 1, Sp1 transcription factor
NCBI Gene AliasesSp1-1, 1110003E12Rik
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Identification of a lipid oxygen radical defense pathway and its epigenetic controlNature CommunicationsDecember 11, 2025Francisco S. Mesquita, Laurence Abrami, Romain Forey, Béatrice Kunz, Charlène Raclot, Lucie Bracq, Filipe Martins, Danica Milovanovic, Evarist Planet, Olga Rosspopoff, et al.(CCCATTGATCTTTCTGATCTA), GPX4 (CGGCTGCGTGGTGAAGCGCTA). The following human siRNA were purchased from Santa Cruz: SP1 (sc-44221), FOXA1 (sc-37930). Mouse siRNA were purchased from Qiagen for mouse ZFP354A (TACCACTTTAATAACATTCAA).

(2) Identification of phosphorylation sites on transcription factor Sp1 in response to DNA damage and its accumulation at damaged sitesCellular signallingOctober 1, 2008Iwahori S, Yasui Y, Kudoh A, Sato Y, Nakayama S, Murata T, Isomura H, Tsurumi T.

Be the First to Write a Review!

Sp1 siRNA (h2)

Sp1 siRNA (h2) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (2)

Reviews

Sp1 siRNA (h2) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map