p27 Kip1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
Itemp27 Kip1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29429
Gene Namecyclin-dependent kinase inhibitor 1B (p27, Kip1)
Quantity10 µM
Specieshuman
NCBI Full Gene Namecyclin dependent kinase inhibitor 1B
NCBI Gene AliasesCDKN4, KIP1, MEN1B, MEN4, P27KIP1
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) PARP14 regulates cyclin D1 expression to promote cell-cycle progressionOncogeneJuly 1, 2021O'Connor MJ, Thakar T, Nicolae CM, Moldovan GL.GCCUGGUGGAGAUGGUGCUAUUGAU; sip53: CUGGAAGACUCCAGUGGUAAUCUAC; sip21: GAUCUUCUCCAAGAGGAAGCCCUAA; sip27:Santa Cruz, sc-29429; sip107: Santa Cruz, sc-29423; siIPO11: Life Tech Silencer Select s27652. For cell cycle analyses, cells

(2) The AHR represses nucleotide excision repair and apoptosis and contributes to UV-induced skin carcinogenesisCell death and differentiationNovember 1, 2018Pollet M, Shaik S, Mescher M, Frauenstein K, Tigges J, Braun SA, Sondenheimer K, Kaveh M, Bruhs A, Meller S, et al.

(3) Cyclin D1 depletion interferes with oxidative balance and promotes cancer cell senescenceJournal of cell scienceJune 25, 2018Laphanuwat P, Likasitwatanakul P, Sittithumcharee G, Thaphaengphan A, Chomanee N, Suppramote O, Ketaroonrut N, Charngkaew K, Lam EW, Okada S, et al.targeted siRNA used in K112E experiment (#s229) was from Thermo Fisher Scientific (MA, USA). The p27 siRNA (sc-29429) was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Cyclin D1 re-expression in senescent cells

(4) Cyclin-Dependent Kinase Inhibitor 3 Promotes Cancer Cell Proliferation and Tumorigenesis in Nasopharyngeal Carcinoma by Targeting p27Oncology researchNovember 2, 2017Wang H, Chen H, Zhou H, Yu W, Lu Z.

(5) Cip2a promotes cell cycle progression in triple-negative breast cancer cells by regulating the expression and nuclear export of p27Kip1OncogeneApril 6, 2017Liu H, Qiu H, Song Y, Liu Y, Wang H, Lu M, Deng M, Gu Y, Yin J, Luo K, et al.

(6) Dasatinib inhibits c-src phosphorylation and prevents the proliferation of Triple-Negative Breast Cancer (TNBC) cells which overexpress Syndecan-Binding Protein (SDCBP)PloS oneJanuary 1, 2017Qian XL, Zhang J, Li PZ, Lang RG, Li WD, Sun H, Liu FF, Guo XJ, Gu F, Fu L.overexpressing SDCBP P27 siRNA interference p27 was downregulated by transiently transfecting siRNA; p27 siRNA (sc-29429) and control siRNA (sc-37007) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, U.S.A.). Cells

(7) MIR-150 promotes prostate cancer stem cell development via suppressing p27Kip1European review for medical and pharmacological sciencesNovember 1, 2015Liu DZ, Zhang HY, Long XL, Zou SL, Zhang XY, Han GY, Cui ZG.

(8) miRNA-24-3p promotes cell proliferation and inhibits apoptosis in human breast cancer by targeting p27Kip1Oncology reportsAugust 1, 2015Lu K, Wang J, Song Y, Zhao S, Liu H, Tang D, Pan B, Zhao H, Zhang Q.by western blot analysis. The siRNA targeting p27Kip1 was purchased from Santa Cruz Biotechnology (sc-29429). The full-length human p27Kipl cDNA (1.5 kb) was subcloned into the EcoRI and BamHI sites of the eukaryotic

(9) DC120, a novel AKT inhibitor, preferentially suppresses nasopharyngeal carcinoma cancer stem-like cells by downregulating Sox2OncotargetMarch 30, 2015Qin J, Ji J, Deng R, Tang J, Yang F, Feng GK, Chen WD, Wu XQ, Qian XJ, Ding K, et al.

(10) Probucol suppresses human glioma cell proliferation in vitro via ROS production and LKB1-AMPK activationActa pharmacologica SinicaDecember 1, 2014Jiang YS, Lei JA, Feng F, Liang QM, Wang FR.

(11) Mitochondrion-associated protein LRPPRC suppresses the initiation of basal levels of autophagy via enhancing Bcl-2 stabilityThe Biochemical journalSeptember 15, 2013Zou J, Yue F, Jiang X, Li W, Yi J, Liu L.(sc-528), Beclin 1 (sc-11427) and GFP (sc-8334), siRNA molecules specific to LRPPRC (sc-44734), p27 (sc-29429) and ATG5 (sc-41445), and random sequence control (sc-44234) were from Santa Cruz Biotechnology. FITC

(12) DFMO/eflornithine inhibits migration and invasion downstream of MYCN and involves p27Kip1 activity in neuroblastomaInternational journal of oncologyApril 1, 2013Koomoa DL, Geerts D, Lange I, Koster J, Pegg AE, Feith DJ, Bachmann AS.siRNA Cells were transfected with siRNA from Santa Cruz Biotechnology, Inc. The p27-specific siRNA (sc-29429) used in this study was as follows: sense: AAGUACGAGUGGCAAGAGGUG and antisense: CACCUCUUGCCACUCGUACUU.

(13) Helicobacter pylori decreases p27 expression through the delta opioid receptor-mediated inhibition of histone acetylation within the p27 promoterCancer lettersDecember 29, 2012Byun SW, Chang YJ, Chung IS, Moss SF, Kim SS.construct was used as previously described [26]. To silence endogenous p27, validated siRNAs for p27kip1 (sc-29429) and control siRNA (sc-37007) were obtained from Santa Cruz. Human gastric epithelial cells were transfected

(14) Terbinafine inhibits oral squamous cell carcinoma growth through anti-cancer cell proliferation and anti-angiogenesisMolecular carcinogenesisMay 1, 2012Chien MH, Lee TS, Kao C, Yang SF, Lee WS.

(15) Galbanic acid decreases androgen receptor abundance and signaling and induces G1 arrest in prostate cancer cellsInternational journal of cancerJanuary 1, 2012Zhang Y, Kim KH, Zhang W, Guo Y, Kim SH, Lü J.

(16) miR-221/222 suppression protects against endoplasmic reticulum stress-induced apoptosis via p27(Kip1)- and MEK/ERK-mediated cell cycle regulationBiological chemistryJuly 1, 2010Dai R, Li J, Liu Y, Yan D, Chen S, Duan C, Liu X, He T, Li H.

(17) Simian virus 40 T/t antigens and lamin A/C small interfering RNA rescue the phenotype of an Epstein-Barr virus protein kinase (BGLF4) mutantJournal of virologyMay 1, 2010Meng Q, Hagemeier SR, Kuny CV, Kalejta RF, Kenney SC.

(18) Cell cycle actions of parathyroid hormone-related protein in non-small cell lung carcinomaAmerican journal of physiology. Lung cellular and molecular physiologyOctober 1, 2009Hastings RH, Montgrain PR, Quintana R, Rascon Y, Deftos LJ, Healy E.

(19) Ginsenoside Rh2-mediated G1 phase cell cycle arrest in human breast cancer cells is caused by p15 Ink4B and p27 Kip1-dependent inhibition of cyclin-dependent kinasesPharmaceutical researchOctober 1, 2009Choi S, Kim TW, Singh SV.

(20) TGFbeta prevents proteasomal degradation of the cyclin-dependent kinase inhibitor p27kip1 for cell cycle arrestCell cycle (Georgetown, Tex.)March 1, 2009Lecanda J, Ganapathy V, D'Aquino-Ardalan C, Evans B, Cadacio C, Ayala A, Gold LI.

Be the First to Write a Review!

p27 Kip1 siRNA (h)

p27 Kip1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (31)

Reviews

p27 Kip1 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map