HNF-3α siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemHNF-3α siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-37930
Gene Nameforkhead box A1
Quantity10 µM
Specieshuman
NCBI Full Gene Nameforkhead box A1
NCBI Gene AliasesHNF3A, TCF3A
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Identification of a lipid oxygen radical defense pathway and its epigenetic controlNature CommunicationsDecember 11, 2025Francisco S. Mesquita, Laurence Abrami, Romain Forey, Béatrice Kunz, Charlène Raclot, Lucie Bracq, Filipe Martins, Danica Milovanovic, Evarist Planet, Olga Rosspopoff, et al.(CGGCTGCGTGGTGAAGCGCTA). The following human siRNA were purchased from Santa Cruz: SP1 (sc-44221), FOXA1 (sc-37930). Mouse siRNA were purchased from Qiagen for mouse ZFP354A (TACCACTTTAATAACATTCAA). As a control siRNA,

(2) Cross-talk between enhancers, structural elements and activating transcription factors maintains the 3D architecture and expression of the CFTR geneGenomicsMay 1, 2022Yin S, NandyMazumdar M, Paranjapye A, Harris A.cm dishes. After 24 h, they were forward transfected with NC siRNA-A (Santa Cruz sc-37007) or FOXA1 (sc-37930) and FOXA2 (sc-35569), CDX2 (sc-43680), or GATA6 (sc-37907) siRNAs at 200 pmol/dish using Lipofectamine

(3) The FOXA1 transcriptional network coordinates key functions of primary human airway epithelial cellsAmerican journal of physiology. Lung cellular and molecular physiologyJuly 1, 2020Paranjapye A, Mutolo MJ, Ebron JS, Leir SH, Harris A.

(4) Resistance to bortezomib in breast cancer cells that downregulate Bim through FOXA1 O-GlcNAcylationJournal of cellular physiologyAugust 1, 2019Liu Y, Wang X, Zhu T, Zhang N, Wang L, Huang T, Cao Y, Li W, Zhang J.

(5) Ets homologous factor (EHF) has critical roles in epithelial dysfunction in airway diseaseThe Journal of biological chemistryJune 30, 2017Fossum SL, Mutolo MJ, Tugores A, Ghosh S, Randell SH, Jones LC, Leir SH, Harris A.

(6) Hormone-induced repression of genes requires BRG1-mediated H1.2 deposition at target promotersThe EMBO journalAugust 15, 2016Nacht AS, Pohl A, Zaurin R, Soronellas D, Quilez J, Sharma P, Wright RH, Beato M, Vicent GP.

(7) Metformin induces apoptosis of human hepatocellular carcinoma HepG2 cells by activating an AMPK/p53/miR-23a/FOXA1 pathwayOncoTargets and therapyJanuary 1, 2016Sun Y, Tao C, Huang X, He H, Shi H, Zhang Q, Wu H.

(8) FOXA2 regulates a network of genes involved in critical functions of human intestinal epithelial cellsPhysiological genomicsJuly 1, 2015Gosalia N, Yang R, Kerschner JL, Harris A.

(9) Architectural proteins CTCF and cohesin have distinct roles in modulating the higher order structure and expression of the CFTR locusNucleic acids researchSeptember 1, 2014Gosalia N, Neems D, Kerschner JL, Kosak ST, Harris A.Lipofectamine® 2000 or RNAiMAX™ (Life Technologies (LT)) and 20 nM hFOXA1 (Santa Cruz Biotechnology (SCB) sc-37930), hFOXA2 (SCB sc-35569) or 40 nm control (SCB sc-37007) siRNA as described (8). Cells were harvested

(10) Chromatin remodeling mediated by the FOXA1/A2 transcription factors activates CFTR expression in intestinal epithelial cellsEpigeneticsApril 1, 2014Kerschner JL, Gosalia N, Leir SH, Harris A.

(11) STAT5 outcompetes STAT3 to regulate the expression of the oncogenic transcriptional modulator BCL6Molecular and cellular biologyAugust 1, 2013Walker SR, Nelson EA, Yeh JE, Pinello L, Yuan GC, Frank DA.Lipofectamine RNAiMax (Invitrogen) with 10 nM small interfering RNA (siRNA) C/EBP␤ (sc-29229), FoxA1 (sc-37930) from Santa Cruz, or control siRNA 3 (D-001210-03; Dharmacon). Seventy-two hours after transfection,

Be the First to Write a Review!

HNF-3α siRNA (h)

HNF-3α siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (11)

Reviews

HNF-3α siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map