N-Myc siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemN-Myc siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-36003
Gene Namev-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
Quantity10 µM
Specieshuman
NCBI Full Gene NameMYCN proto-oncogene, bHLH transcription factor
NCBI Gene AliasesMODED, MYCNsORF, MYCNsPEP, N-myc, NMYC, ODED, bHLHe37
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Aryl hydrocarbon receptor is a tumor promoter in MYCN-amplified neuroblastoma cells through suppression of differentiationiScienceNovember 17, 2023Kanita A. Chaudhry, Justine J. Jacobi, Bryan M. Gillard, Ellen Karasik, Jeffrey C. Martin, Tatiane da Silva Fernandes, Edward Hurley, Maria Laura Feltri, Kristopher M. Attwood, Clare J. Twist, et al.Colony,N/A ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, siRNA pools against MYCN,Santa Cruz Biotechnology,Cat#sc-36003 Primer for MYCN amplification qRT-PCR_FWD 5′ CACAAGGCCCTCAGTACCTC 3′,This Paper,N/A Primer for MYCN

(2) MYCN mRNA degradation and cancer suppression by a selective small-molecule inhibitor in MYCN-amplified neuroblastomaFrontiers in oncologyJanuary 1, 2022Liu T, Gu L, Wu Z, Albadari N, Li W, Zhou M.time period indicated, with the final DMSO concentration kept constant in each experiment. The siMYCN (sc-36003, purchased from Santa Cruz) and miRNA let-7 inhibitor (human antisense-let-7a (has-let-7), purchased

(3) Lipid desaturation-associated endoplasmic reticulum stress regulates MYCN gene expression in hepatocellular carcinoma cellsCell death & diseaseJanuary 27, 2020Qin XY, Su T, Yu W, Kojima S.RNA interference A pool of 3 target-specific siRNAs targeting human SCD1 (sc-36464; siSCD1), human MYCN (sc-36003; siMYCN), human ATF3 (sc-44283; siATF3) and a control siRNA (sc-37007; siCtl) were purchased from Santa Cruz Biotechnology

(4) Inhibition of N-myc expression sensitizes human neuroblastoma IMR-32 cells expressing caspase-8 to TRAILCell proliferationMay 1, 2019Lee MW, Kim DS, Kim HR, Park HJ, Lee JW, Sung KW, Koo HH, Yoo KH.

(5) Targeting the Difficult-to-Drug CD71 and MYCN with Gambogic Acid and Vorinostat in a Class of NeuroblastomasCellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacologyJanuary 1, 2019Bishayee K, Habib K, Sadra A, Huh SO.down gene expression (Product numbers: ͳͺ͵ ͲͲͲͲʹ͸ͳ ͲͲͲ͵ͳͷͲ͹ MYCN siRNA (h): sc-36003; CD71 siRNA (h): sc 37070; HDAC2 siRNA (h): sc-29345) and were purchased from Santa Cruz Biotechnology

(6) JQ1 synergizes with the Bcl-2 inhibitor ABT-263 against MYCN-amplified small cell lung cancerOncotargetOctober 17, 2017Wang H, Hong B, Li X, Deng K, Li H, Yan Lui VW, Lin W.

(7) MycN promotes TRPM7 expression and cell migration in neuroblastoma through a process that involves polyaminesFEBS open bioJanuary 1, 2014Lange I, Koomoa DL.

(8) N-Myc knockdown and apigenin treatment controlled growth of malignant neuroblastoma cells having N-Myc amplificationGeneOctober 15, 2013Hossain MM, Banik NL, Ray SK.

Be the First to Write a Review!

N-Myc siRNA (h)

N-Myc siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (8)

Reviews

N-Myc siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map