Topo IIα siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemTopo IIα siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-36695
Gene Nametopoisomerase (DNA) II alpha 170kDa
Quantity10 µM
Specieshuman
NCBI Full Gene NameDNA topoisomerase II alpha
NCBI Gene AliasesTOP2, TOP2alpha, TOPIIA, TP2A
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Cotargeting DNA topoisomerase II enhances efficacy of RAS-targeted therapy in KRAS-mutant cancer modelsJ Clin InvestFebruary 16, 2026Rongzhong Xu, Dongsheng Wang, Guangzhi Ma, Xun Yuan, Qian Chu, Songqing Fan, Rener Zhang, Pan Du, Shidong Jia, Ticiana A. Leal, et al.primers were the same as described previously (9). Gene knockdown using siRNA and shRNA. TOP2A siRNA (sc-36695), TOP2A shRNA plasmid (sc-36695-SH), and Bim siRNA (sc-29803) were purchased from Santa Cruz Biotechnology.

(2) DNA topoisomerase II inhibition potentiates osimertinib’s therapeutic efficacy in EGFR-mutant non–small cell lung cancer modelsJournal of Clinical InvestigationMay 15, 2024Zhen Chen, Karin A. Vallega, Dongsheng Wang, Zihan Quan, Songqing Fan, Qiming Wang, Ticiana Leal, Suresh S. Ramalingam, Shi-Yong Sun(forward) and 5′-ACCACCCTGTTGCTGTAGCCAA-3′ (reverse). Gene knockdown using siRNA and shRNA. TOP2A siRNA (sc-36695), TOP2A shRNA plasmid (sc-36695-SH), SMURF2 siRNA (sc-41675), and SMURF2 shRNA plasmid (sc-41675-SH)

(3) YM155 Induces DNA Damage and Cell Death in Anaplastic Thyroid Cancer Cells by Inhibiting DNA Topoisomerase IIα at the ATP-Binding SiteMolecular cancer therapeuticsJune 1, 2022Mackay RP, Weinberger PM, Copland JA, Mahdavian E, Xu Q.(39,40) with the same parameters applied to all groups. siRNA transfection. A Top2α siRNA pool (h) (SC-36695), control nonsense siRNA (SC-37007), transfection media (SC-36868) and transfection reagent (SC29528)

(4) Propofol modulates the proliferation, invasion and migration of bladder cancer cells through the miR‑145‑5p/TOP2A axisMolecular medicine reportsJune 1, 2021Du Y, Zhang X, Zhang H, Chen Y, Zhu S, Shu J, Pan H.

(5) The Inhibition of miR-144-3p on Cell Proliferation and Metastasis by Targeting TOP2A in HCMV-Positive Glioblastoma CellsMolecules (Basel, Switzerland)December 10, 2018Song J, Ma Q, Hu M, Qian D, Wang B, He N.

(6) Constricted migration increases DNA damage and independently represses cell cycleMolecular biology of the cellAugust 8, 2018Pfeifer CR, Xia Y, Zhu K, Liu D, Irianto J, García VMM, Millán LMS, Niese B, Harding S, Deviri D, et al.Pennsylvania (Cho et al., 2015). We used small interfering RNAs (siRNAs) purchased from Santa Cruz (siTOP2A, sc-36695) and Dharmacon (ON-TARGETplus SMARTpool siBRCA1, L-003461-00; siBRCA2, L-003462-00; siKu80, L-010491-00;

(7) All-trans retinoic acid suppresses topoisomerase IIα through the proteasomal pathwayAnti-cancer drugsAugust 1, 2015Li X, Li Y, Shen X, Fu S, Han S, Feng Q.

(8) Regulation of Hepatic Cholesteryl Ester Transfer Protein Expression and Reverse Cholesterol Transport by Inhibition of DNA Topoisomerase IIThe Journal of biological chemistryJune 5, 2015Liu M, Chen Y, Zhang L, Wang Q, Ma X, Li X, Xiang R, Zhu Y, Qin S, Yu Y, et al.

(9) TOPBP1 recruits TOP2A to ultra-fine anaphase bridges to aid in their resolutionNature communicationsMarch 12, 2015Broderick R, Nieminuszczy J, Blackford AN, Winczura A, Niedzwiedz W.instructions. RNAi treatment siRNAs targeting human 53BP1 (sc-37455) and BRG1 (sc-29827) and TOP2A (sc-36695) were obtained from Santa Cruz Biotechnology. siRNA pools targeting MDC1 (L-003506-00) and PICH (L-031581-01)

(10) Geminin overexpression prevents the completion of topoisomerase IIα chromosome decatenation, leading to aneuploidy in human mammary epithelial cellsBreast cancer research : BCRMay 19, 2011Gardner L, Malik R, Shimizu Y, Mullins N, ElShamy WM.TGAGCTGTCCGCAGGCTTT, scrambled siGem: TGATTTGTCCGCAGCTGGC, siCdc7: TTTGTGAACACCTTTCCTGTT and siTopoIIα: sc-36695 (Santa Cruz Biotechnology). The silenced luciferase (siLuc) and silenced green fluorescence protein

Be the First to Write a Review!

Topo IIα siRNA (h)

Topo IIα siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (10)

Reviews

Topo IIα siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map