LKLF siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemLKLF siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-35818
Gene NameKruppel-like factor 2 (lung)
Quantity10 µM
Specieshuman
NCBI Full Gene NameKLF transcription factor 2
NCBI Gene AliasesLKLF
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) mTOR contributes to endothelium-dependent vasorelaxation by promoting eNOS expression and preventing eNOS uncouplingCommunications biologyJuly 22, 2022Wang Y, Li Q, Zhang Z, Peng K, Zhang DM, Yang Q, Passerini AG, Simon SI, Sun C.pharmacological inhibitors. Cell transfection Negative control siRNA (sc-37007), siRNA targeting KLF2 (sc-35818), RPTOR (encoding Raptor) (sc-44069), RICTOR (sc-61478), MTOR (sc-35409), RPS6KB1 (encoding p70S6K)

(2) Renoprotective Effect of KLF2 on Glomerular Endothelial Dysfunction in Hypertensive NephropathyCellsFebruary 22, 2022Bae E, Yu MY, Moon JJ, Kim JE, Lee S, Han SW, Park DJ, Kim YS, Yang SH.interfering RNA (siRNA) targeting KLF2 was purchased from Santa Cruz Biotechnology (Dallas, TX, USA, sc-35818). To inhibit KLF2 activity, siRNA was transfected into hPGECs, as described in the manufacturer’s protocol.

(3) Calycosin ameliorates atherosclerosis by enhancing autophagy via regulating the interaction between KLF2 and MLKL in apolipoprotein E gene-deleted miceBritish journal of pharmacologyJanuary 1, 2022Ma C, Wu H, Yang G, Xiang J, Feng K, Zhang J, Hua Y, Kang L, Fan G, Yang S.

(4) G protein-coupled estrogen receptor regulates the KLF2-dependent eNOS expression by activating of Ca(2+) and EGFR signaling pathway in human endothelial cellsBiochemical pharmacologyOctober 1, 2021Park JS, Lee GH, Jin SW, Pham TH, Thai TN, Kim JY, Kim CY, Han EH, Hwang YP, Choi CY, et al.

(5) Betulinic Acid Induces eNOS Expression via the AMPK-Dependent KLF2 Signaling PathwayJournal of agricultural and food chemistryDecember 9, 2020Lee GH, Park JS, Jin SW, Pham TH, Thai TN, Kim JY, Kim CY, Choi JH, Han EH, Jeong HG.

(6) Rapamycin Regulates the Expression and Activity of Krüppel-Like Transcription Factor 2 in Human Umbilical Vein Endothelial CellsPLoS ONEAugust 24, 2012Qian Ma, Xiaomin Nie, Miao Yu, Zhijian Wang, Shiwei Yang, Dean Jia, Yujie ZhouGCACCGACGACGACCUCAAUU, UCAACAGCGUGCUGGACUUUU, and UGCUGGAGGCCAAGCCAAAUU. 30 nM of RNAi (Santa Cruz, sc-35818) duplex was transiently transfected with Lipofectamine™ RNAiMAX transfection reagent (Invitrogen). After

Be the First to Write a Review!

LKLF siRNA (h)

LKLF siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (6)

Reviews

LKLF siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map