Mfn1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemMfn1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-43927
Gene Namemitofusin 1
Quantity10 µM
Specieshuman
NCBI Full Gene Namemitofusin 1
NCBI Gene Aliaseshfzo1, hfzo2
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Promotion of maturation of human pluripotent stem cell-derived cardiomyocytes via treatment with the peroxisome proliferator-activated receptor alpha agonist FenofibrateStem Cells Translational MedicineAugust 16, 2024Seul-Gi Lee, Jooeon Rhee, Jin Seok, Jin Kim, Min Woo Kim, Gyeong-Eun Song, Shinhye Park, Kyu Sik Jeong, Suemin Lee, Yun Hyeong Lee, et al.Inc.).18 siRNA transfection Both siRNA against CTL (siCTL; sc-37007) and siRNA targeting MFN1 (siMFN1; sc-43927) were purchased from Santa Cruz Biotechnology. Transfection was performed following the manufacturer’s

(2) Mitofusin-2 stabilizes adherens junctions and suppresses endothelial inflammation via modulation of β-catenin signalingNature communicationsMay 12, 2021Kim YM, Krantz S, Jambusaria A, Toth PT, Moon HG, Gunarathna I, Park GY, Rehman J.Biology, VIB, Leuven, Belgium. We obtained siRNA for beta-catenin (sc-29209), Mfn2 (sc-43928), Mfn1 (sc-43927), Drp1 (sc-43732), Opa1(sc-106808) or control (sc-37007) from Santa Cruz Biotechnologies. Lentivirus

(3) Actin cables and comet tails organize mitochondrial networks in mitosisNatureMarch 1, 2021Moore AS, Coscia SM, Simpson CL, Ortega FE, Wait EC, Heddleston JM, Nirschl JJ, Obara CJ, Guedes-Dias P, Boecker CA, et al.43200), Gelsolin (SantaCruz, sc-37330), Spire1C (Dharmacon, CCUAGGAUAACCAGUGUAUUU), MFN1 (Santa Cruz, sc-43927), MFN2 (Santa Cruz, sc-43928). Cell culture HeLa-M (A.Peden, Cambridge, UK), HaCaT (ATCC), COS-7 (ATCC),

(4) A novel protein encoded by circular SMO RNA is essential for Hedgehog signaling activation and glioblastoma tumorigenicityGenome biologyJanuary 14, 2021Wu X, Xiao S, Zhang M, Yang L, Zhong J, Li B, Li F, Xia X, Li X, Zhou H, et al.per 500μg total protein for IP), GRK2 (#sc-13143; 1 μg per 500μg total protein for IP), and Nestin (#sc-43927; 1:250 for IHC) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Anti-Tuj-1 (#MAB1195,

(5) The Causal Role of Mitochondrial Dynamics in Regulating Innate Immunity in DiabetesFrontiers in endocrinologyJanuary 1, 2020Chang YH, Lin HY, Shen FC, Su YJ, Chuang JH, Lin TK, Liou CW, Lin CY, Weng SW, Wang PW.used as mock control (Technologies, Inc., Rockville, MD, USA). For siRNA knockdown, interfering RNAs (sc-43927; sc-43928; sc-43732; sc-60643; Santa Cruz Biotechnology, Santa Cruz, CA) were delivered using Lipofectamine

(6) Myoglobin induces mitochondrial fusion, thereby inhibiting breast cancer cell proliferationThe Journal of biological chemistryMay 3, 2019Braganza A, Quesnelle K, Bickta J, Reyes C, Wang Y, Jessup M, St Croix C, Arlotti J, Singh SV, Shiva S.

(7) The Causal Role of Mitochondrial Dynamics in Regulating Insulin Resistance in Diabetes: Link through Mitochondrial Reactive Oxygen SpeciesOxidative medicine and cellular longevityJanuary 1, 2018Lin HY, Weng SW, Chang YH, Su YJ, Chang CM, Tsai CJ, Shen FC, Chuang JH, Lin TK, Liou CW, et al.(RG207184; RG202218; RG202046; RG202560; Origene Technologies, Inc., Rockville, MD, USA) and siRNA (sc-43927; sc-43928; sc-43732; sc-60643; Santa Cruz Biotechnology, Santa Cruz, CA) spanned 24 and 48 h, respectively. Mock

(8) A neuronal network of mitochondrial dynamics regulates metastasisNature communicationsDecember 19, 2016Caino MC, Seo JH, Aguinaldo A, Wait E, Bryant KG, Kossenkov AV, Hayden JE, Vaira V, Morotti A, Ferrero S, et al.(Santa Cruz, sc-36777), Miro1 (Santa Cruz, sc-93809), Miro2 (Santa Cruz, sc-93029), Mfn1 (Santa Cruz sc-43927) or Mfn2 (Santa Cruz sc-43928). Tumour cells were transfected with the individual siRNA pools at 30–60

(9) PI3K therapy reprograms mitochondrial trafficking to fuel tumor cell invasionProceedings of the National Academy of Sciences of the United States of AmericaJuly 14, 2015Caino MC, Ghosh JC, Chae YC, Vaira V, Rivadeneira DB, Faversani A, Rampini P, Kossenkov AV, Aird KM, Zhang R, et al.

Be the First to Write a Review!

Mfn1 siRNA (h)

Mfn1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (9)

Reviews

Mfn1 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map