XIAP siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemXIAP siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-37508
Gene NameX-linked inhibitor of apoptosis
Quantity10 µM
Specieshuman
NCBI Full Gene NameX-linked inhibitor of apoptosis
NCBI Gene AliasesAPI3, BIRC4, IAP-3, ILP1, MIHA, XLP2, hIAP-3, hIAP3
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) E3 ligase Skp2-mediated stabilization of survivin contributes to radioresistanceCell Death DiscovApril 7, 2025Shiming Tan, Ruirui Wang, Jinglin Fang, Ming Yi, Pengfei Guo, Shuangze Han, Xiaoying Li, Yu Gan, Jinzhuang Liao, Xinfang Yu, et al.CCAGAGACCTTTAGCAGCTC; sgRNA#2 for Skp2: TCCCTCCAAAGGTGTTTCAT; siSurvivin (sc-29499), siFBXL7 (sc-62306), and siXIAP (sc-37508) were purchased from Santa Cruz Biotechnology. MTS assay To analyze the effects of ionizing radiation

(2) TRAF4 regulates ubiquitination-modulated survivin turnover and confers radioresistanceInternational Journal of Biological SciencesJanuary 1, 2024Jinzhuang Liao, Xiang Qing, Xiaoying Li, Yu Gan, Ruirui Wang, Shuangze Han, Wei Li, Wei Songdescribed previously 16, 33. siRNA The siCtrl (sc-37,007), survivin siRNA (sc-29499), XIAP siRNA (sc-37508), and FBXL7 siRNA (sc-62,306) were obtained from Santa Cruz Biotechnology (Dalla, TX). siRNA transfection

(3) Neddylation of PTEN regulates its nuclear import and promotes tumor developmentCell researchMarch 1, 2021Xie P, Peng Z, Chen Y, Li H, Du M, Tan Y, Zhang X, Lu Z, Cui CP, Liu CH, et al.

(4) Targeting X chromosome-linked inhibitor of apoptosis protein in mucoepidermoid carcinoma of the head and neck: A novel therapeutic strategy using nitidine chlorideJournal of molecular medicine (Berlin, Germany)November 1, 2020Kwon HJ, Yoon K, Jung JY, Ryu MH, Kim SH, Yoo ES, Choi SY, Yang IH, Hong SD, Shin JA, et al.

(5) Engeletin suppresses lung cancer progression by inducing apoptotic cell death through modulating the XIAP signaling pathway: A molecular mechanism involving ER stressBiomedicine & pharmacotherapy = Biomedecine & pharmacotherapieAugust 1, 2020Liu T, Li Y, Sun J, Tian G, Shi Z.

(6) Bacterial CagA protein compromises tumor suppressor mechanisms in gastric epithelial cellsThe Journal of clinical investigationMay 1, 2020Palrasu M, Zaika E, El-Rifai W, Garcia-Buitrago M, Piazuelo MB, Wilson KT, Peek RM Jr, Zaika AI.(5′-CACAGCACUUUCUCGUACAUGUCACUG-3′) was synthesized by Integrated DNA Technologies. PI3K (catalog sc-37269), XIAP (catalog sc-37508), Cbl-b (catalog sc-29950), and Akt (catalog sc-43609) siRNA were purchased from Santa Cruz Biotechnology.

(7) lncRNA LSINCT5 Regulates miR-20a-5p/XIAP to Inhibit the Growth and Metastasis of Osteosarcoma CellsOncoTargets and therapyJanuary 1, 2020Liao SA, Guan J, Mo H, He JL, Zhan XL.

(8) Identification of hub genes associated with RNAi-induced silencing of XIAP through targeted proteomics approach in MCF7 cellsCell & bioscienceJanuary 1, 2020Gholizadeh MA, Shamsabadi FT, Yamchi A, Golalipour M, Jhingan GD, Shahbazi M.obtained from Sigma Co. (St. Louis, Mo). The XIAP siRNA was purchased from Santa Cruz Biotechnology Inc (sc-37508, Santa Cruz, Inc). Cell culture and transfection The breast cancer cell line MCF-7 were cultured at

(9) Cannabidiol promotes apoptosis via regulation of XIAP/Smac in gastric cancerCell death & diseaseNovember 7, 2019Jeong S, Jo MJ, Yun HK, Kim DY, Kim BR, Kim JL, Park SH, Na YJ, Jeong YA, Kim BG, et al.

(10) Heightened JNK Activation and Reduced XIAP Levels Promote TRAIL and Sunitinib-Mediated Apoptosis in Colon Cancer ModelsCancersJune 26, 2019Mahalingam D, Carew JS, Espitia CM, Cool RH, Giles FJ, de Jong S, Nawrocki ST.

(11) Sea Cucumber (Stichopus japonicas) F2 Enhanced TRAIL-Induced Apoptosis via XIAP Ubiquitination and ER Stress in Colorectal Cancer CellsNutrientsMay 11, 2019Kim JL, Park SH, Jeong S, Kim BR, Na YJ, Jo MJ, Jeong YA, Yun HK, Kim DY, Kim BG, et al.(ELISA) microplate reader. 2.4. Transfection of Small Interfering RNA (siRNA) XIAP siRNA (Cat. No. SC-37508) and negative Control siRNA (Cat. No. SC-37007) were purchased from Santa Cruz Biotechnology (Santa

(12) Piceatannol-Induced Apoptosis Is Reversed by N-Acetyl-L-cysteine through Restoration of XIAP ExpressionBiological & pharmaceutical bulletinJanuary 1, 2018Jin CY, Molagoda IMN, Park C, Kwon TK, Yun SJ, Kim WJ, Kim GY, Choi YH.

(13) Lentivirus-mediated miR-23a overexpression induces trophoblast cell apoptosis through inhibiting X-linked inhibitor of apoptosisBiomedicine & pharmacotherapy = Biomedecine & pharmacotherapieOctober 1, 2017Li L, Hou A, Gao X, Zhang J, Zhang L, Wang J, Li H, Song Y.

(14) Overexpression of X chromosome-linked inhibitor of apoptosis by inhibiting microRNA-24 protects periodontal ligament cells against hydrogen peroxide-induced cell apoptosisCellular and molecular biology (Noisy-le-Grand, France)April 30, 2016Liu C, Chen Z, Wang J, Hu H.

(15) Carbon-Ion Irradiation Suppresses Migration and Invasiveness of Human Pancreatic Carcinoma Cells MIAPaCa-2 via Rac1 and RhoA DegradationInternational journal of radiation oncology, biology, physicsSeptember 1, 2015Fujita M, Imadome K, Shoji Y, Isozaki T, Endo S, Yamada S, Imai T.

(16) Inhibition of MDM2 homodimerization by XIAP IRES stabilizes MDM2, influencing cancer cell survivalMolecular cancerMarch 26, 2015Liu T, Zhang H, Xiong J, Yi S, Gu L, Zhou M.

(17) HtrA1 resensitizes multidrug-resistant hepatocellular carcinoma cells by targeting XIAPBiomedicine & pharmacotherapy = Biomedecine & pharmacotherapieMarch 1, 2015Bao W, Zhu F, Duan Y, Yang Y, Cai H.

(18) Prostate apoptosis response-4 mediates TGF-β-induced epithelial-to-mesenchymal transitionCell death & diseaseFebruary 6, 2014Chaudhry P, Fabi F, Singh M, Parent S, Leblanc V, Asselin E.

(19) An anthraquinone derivative, emodin sensitizes hepatocellular carcinoma cells to TRAIL induced apoptosis through the induction of death receptors and downregulation of cell survival proteinsApoptosis : an international journal on programmed cell deathOctober 1, 2013Subramaniam A, Loo SY, Rajendran P, Manu KA, Perumal E, Li F, Shanmugam MK, Siveen KS, Park JI, Ahn KS, et al.

(20) Hydroxycamptothecin induces apoptosis and inhibits tumor growth in colon cancer by the downregulation of survivin and XIAP expressionWorld journal of surgical oncologyMay 30, 2013Fei B, Chi AL, Weng Y.

Be the First to Write a Review!

XIAP siRNA (h)

XIAP siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (25)

Reviews

XIAP siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map