Mcl-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemMcl-1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-35877
Quantity10 µM
Gene Namemyeloid cell leukemia sequence 1 (BCL2-related)
Specieshuman
TypesiRNA/dsRNA
NCBI Full Gene NameMCL1 apoptosis regulator, BCL2 family member
NCBI Gene AliasesBCL2L3, EAT, MCL1-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Targeting MCL1 by UMI-77 to induce mitophagy alleviates renal tubular epithelial cells injury in acute kidney injuryScientific ReportsDecember 29, 2025Xiaoyu Li, Zixian Li, Yongming Chen, Hongluan Wu, Yonghan Liu, Zhennan Ye, Qingqing Yang, Haicha Hou, Junfeng Hao, Ruigao Song, et al.an in vitro hypoxia/reoxygenation (H/R) model. Before H/R, the siRNAs specific to MCL-1 (si-MCL-1) (sc-35877, Santa Cruz Biotechnology) were transfected into HK-2 cells to knock down MCL-1. The cell H/R model

(2) The GSK3β/Mcl-1 axis is regulated by both FLT3-ITD and Axl and determines the apoptosis induction abilities of FLT3-ITD inhibitorsCell death discoveryFebruary 4, 2023Qiu Y, Li Y, Chai M, Hua H, Wang R, Waxman S, Jing Y.were obtained from Cell Signaling Technology, Inc. (Beverly, MA); and siRNAs for AXL (sc-29769), MCL1 (sc-35877) and BIM (sc-29802) were obtained from Santa Cruz Biotechnology (San Diego, CA). Cell lines MOLM-13

(3) Targeting anti-apoptotic pathways eliminates senescent melanocytes and leads to nevi regressionNature communicationsDecember 23, 2022Kohli J, Ge C, Fitsiou E, Doepner M, Brandenburg SM, Faller WJ, Ridky TW, Demaria M.96 well plates were used for siRNA transfections. Cells were transfected with 20 pmols Mcl-1 siRNA (sc-35877, Santa Cruz) or 20 pmols control siRNA (sc-37007, Santa Cruz) using the siRNA reagent system (Santa Cruz

(4) Stabilization of MCL-1 by E3 ligase TRAF4 confers radioresistanceCell death & diseaseDecember 19, 2022Li M, Gao F, Li X, Gan Y, Han S, Yu X, Liu H, Li W.weeks. OSCC cells were seeded in 6-well plates and transfected with MCL1 small interfering (si)RNA (sc-35877, Santa Cruz Biotechnology, Inc.) and Ctrl siRNA (sc-37007, Santa Cruz Biotechnology, Inc.) using HiPerFect transfection reagent

(5) Artesunate improves venetoclax plus cytarabine AML cell targeting by regulating the Noxa/Bim/Mcl-1/p-Chk1 axisCell death & diseaseApril 20, 2022Zhang J, Wang Y, Yin C, Gong P, Zhang Z, Zhao L, Waxman S, Jing Y.from Abcam, Inc. Bak (Ab-1) was obtained from Merck Millipore. NOXA(sc-37305), BIM(sc-29802), MCL1(sc-35877)siRNA, and a control siRNA were purchased from Santa Cruz Biotechnology, Inc. NOXA(s10708), BIM(s195011),

(6) Skp2 stabilizes Mcl-1 and confers radioresistance in colorectal cancerCell death & diseaseMarch 18, 2022Yu X, Zhou L, Liu W, Liu L, Gao F, Li W, Liu H.(AAACCCAGGGCTGCCTTGGAAAAG), and selected by 1 mg/mL puromycin for 3 weeks. The Control siRNA (sc-37007), Mcl-1 siRNA (sc-35877), FBW7 siRNA (sc-37547) were purchased from Santa Cruz Biotechnology (Dallas, TX). Cells were grown

(7) SD-36 promotes growth inhibition and induces apoptosis via suppression of Mcl-1 in gliomaJournal of cellular and molecular medicineSeptember 1, 2021Kong S, Ge X, Li X, Liu Z, Zhang R, Yang M, Wang Z, Li Z.

(8) Mcl-1 targeting strategies unlock the proapoptotic potential of TRAIL in melanoma cellsMolecular carcinogenesisNovember 1, 2020Sarif Z, Tolksdorf B, Fechner H, Eberle J.

(9) Aspirin Induced Glioma Apoptosis through Noxa UpregulationInternational journal of molecular sciencesJune 13, 2020Chang CY, Pan PH, Li JR, Ou YC, Wang JD, Liao SL, Chen WY, Wang WY, Chen CJ.

(10) Trametinib potentiates TRAIL-induced apoptosis via FBW7-dependent Mcl-1 degradation in colorectal cancer cellsJournal of cellular and molecular medicineJune 1, 2020Lin L, Ding D, Xiao X, Li B, Cao P, Li S.a density of 20%‐30% 24 hours before treatment. 2.2 Gene silencing (siRNA) siRNAs against Mcl‐1 (sc‐35877) and FBW7 (sc‐37547) and a control siRNA (scrambled; sc‐37007) were obtained from Santa Cruz Biotechnology

(11) BRD4 Levels Determine the Response of Human Lung Cancer Cells to BET Degraders That Potently Induce Apoptosis through Suppression of Mcl-1Cancer researchJune 1, 2020Zong D, Gu J, Cavalcante GC, Yao W, Zhang G, Wang S, Owonikoko TK, He X, Sun SY.

(12) Histone deacetylase inhibitors valproic acid and vorinostat enhance trastuzumab-mediated antibody-dependent cell-mediated phagocytosisJournal for immunotherapy of cancerJanuary 1, 2020Laengle J, Kabiljo J, Hunter L, Homola J, Prodinger S, Egger G, Bergmann M.to the manufacturer’s protocol. Test groups were transfected with MCL1 small interfering RNA (siRNA; sc-35877; Santa Cruz, Texas, USA), whereas control groups were transfected with AllStars Negative Control siRNA

(13) Degradation of MCL-1 by bufalin reverses acquired resistance to osimertinib in EGFR-mutant lung cancerToxicology and applied pharmacologySeptember 15, 2019Cao F, Gong YB, Kang XH, Lu ZH, Wang Y, Zhao KL, Miao ZH, Liao MJ, Xu ZY.

(14) Genipin induces mitochondrial dysfunction and apoptosis via downregulation of Stat3/mcl-1 pathway in gastric cancerBMC cancerJuly 27, 2019Jo MJ, Jeong S, Yun HK, Kim DY, Kim BR, Kim JL, Na YJ, Park SH, Jeong YA, Kim BG, et al.

(15) C6 ceramide motivates the anticancer sensibility induced by PKC412 in preclinical head and neck squamous cell carcinoma modelsJournal of cellular physiologyDecember 1, 2018Zhu Y, Wang C, Zhou Y, Ma N, Zhou J.

(16) Aspirin restores ABT-737-mediated apoptosis in human renal carcinoma cellsBiochemical and biophysical research communicationsJuly 12, 2018Ou YC, Li JR, Wang JD, Chen WY, Kuan YH, Yang CP, Liao SL, Lu HC, Chen CJ.

(17) Antiapoptotic BCL-2 proteins determine sorafenib/regorafenib resistance and BH3-mimetic efficacy in hepatocellular carcinomaOncotargetMarch 30, 2018Tutusaus A, Stefanovic M, Boix L, Cucarull B, Zamora A, Blasco L, de Frutos PG, Reig M, Fernandez-Checa JC, Marí M, et al.Scientific, Rockford, IL). BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), MCL-1 siRNA (h) (sc-35877) and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas, TX). Lipofectamine2000

(18) Imperatorin Targets MCL-1 to Sensitize CD133+ Lung Cancer Cells to γδ-T Cell-Mediated CytotoxicityCellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacologyJanuary 1, 2018You C, Yang Y, Gao B.

(19) MYC and MCL1 Cooperatively Promote Chemotherapy-Resistant Breast Cancer Stem Cells via Regulation of Mitochondrial Oxidative PhosphorylationCell metabolismOctober 3, 2017Lee KM, Giltnane JM, Balko JM, Schwarz LJ, Guerrero-Zotano AL, Hutchinson KE, Nixon MJ, Estrada MV, Sánchez V, Sanders ME, et al.

(20) Inhibition of Mcl-1 enhances Pevonedistat-triggered apoptosis in osteosarcoma cellsExperimental cell researchSeptember 15, 2017Zhang Y, Shi C, Yin L, Zhou W, Wang H, Seng J, Li W.

Be the First to Write a Review!

Mcl-1 siRNA (h)

Mcl-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (79)

Reviews

Mcl-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map