Optineurin siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemOptineurin siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-39054
Quantity10 µM
Gene Nameoptineurin
Specieshuman
TypesiRNA/dsRNA
NCBI Full Gene Nameoptineurin
NCBI Gene AliasesALS12, FIP2, GLC1E, HIP7, HYPL, NRP, TFIIIA-INTP

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Targeted autophagic clearance of Tau protects against Alzheimer's disease through amelioration of Tau-mediated lysosomal stressTheranosticsAugust 16, 2025Bo Hyun Yoon, Jinho Kim, Sandip Sengupta, Chan-Jung Park, Minjoo Ko, Ji Hee Kang, Young Tag Ko, Yeji Kim, Seung Min Lim, Yoonhee Bae, et al.RT-PCR T-REx-Tau40-HEK293 cells were transfected with NDP52 siRNA (Santa Cruz, sc-93738), OPTN siRNA (Santa Cruz, sc-39054), siATG7 #1 (AUCAGGCACUGCUCUUGAA), siATG7 #2 (GCACUAGAGUGUGCAUAUG), siATG7 #3 (CAGUGGAUCUAAAUCUCAAACUGAU)

(2) DJ-1 is an essential downstream mediator in PINK1/parkin-dependent mitophagyBrain : a journal of neurologyDecember 19, 2022Imberechts D, Kinnart I, Wauters F, Terbeek J, Manders L, Wierda K, Eggermont K, Madeiro RF, Sue C, Verfaillie C, et al.OPTN siRNA1 (Thermo Fisher, S19720) was 5′-GACTTGAAGTTGCACTCAATT-3′. OPTN siRNA2 was from Santa Cruz (sc-39054) and is a pool of three siRNAs with the following target sequences: 5′-CCAAGAATTACTTCGAACATT-3′, 5′-CCATCAGAGTTGAATGAAATT-3′

(3) AMBRA1 regulates mitophagy by interacting with ATAD3A and promoting PINK1 stabilityAutophagyAugust 1, 2022Di Rienzo M, Romagnoli A, Ciccosanti F, Refolo G, Consalvi V, Arena G, Valente EM, Piacentini M, Fimia GM.anti-TOMM20 (F10; Santa Cruz Biotechnology, sc-17764), mouse anti-TOMM70 (Santa Cruz Biotechnology, sc-39054), mouse anti-Ox-PhosII SDHA (Invitrogen, 459200), rabbit anti-ATAD3 (Abnova, H00055210-D01), mouse anti-ATAD3

(4) Autophagy Receptor Protein Tax1-Binding Protein 1/TRAF6-Binding Protein Is a Cellular Substrate of Enteroviral ProteinaseFrontiers in microbiologyJanuary 1, 2021Mohamud Y, Xue YC, Liu H, Ng CS, Bahreyni A, Luo H.The scrambled small interfering RNA (siRNA; sc-37007) and siRNAs targeting NDP52 (sc-93738), OPTN (sc-39054), and T6BP (sc-106831) were purchased from Santa Cruz Biotechnology. For transfection, cells were transiently

(5) Coxsackievirus B Escapes the Infected Cell in Ejected MitophagosomesJournal of virologyDecember 15, 2017Sin J, McIntyre L, Stotland A, Feuer R, Gottlieb RA.infected. Optineurin siRNA (mouse [Santa Cruz Biotechnology; SC-39055] and human [Santa Cruz Biotechnology; SC-39054]) was reconstituted by following the manufacturer-provided datasheet. HL-1 cells were transfected using

(6) Linear ubiquitination is involved in the pathogenesis of optineurin-associated amyotrophic lateral sclerosisNature communicationsAugust 24, 2016Nakazawa S, Oikawa D, Ishii R, Ayaki T, Takahashi H, Takeda H, Ishitani R, Kamei K, Takeyoshi I, Kawakami H, et al.Lipofectamine 2000 or TurboFect (Thermo Fisher). For KD experiments, control siRNA (sc-37007) and OPTN siRNA (sc-39054), obtained from Santa Cruz Biotechnology, were transfected by Lipofectamine RNAiMAX (Thermo Fisher). The

Be the First to Write a Review!