PTP1B siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemPTP1B siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-36328
Gene Nameprotein tyrosine phosphatase, non-receptor type 1
Quantity10 µM
Specieshuman
NCBI Full Gene Nameprotein tyrosine phosphatase non-receptor type 1
NCBI Gene AliasesPTP1B
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Cigarette smoke alters calcium flux to induce PP2A membrane trafficking and endothelial cell permeabilityScientific ReportsNovember 14, 2024Abdoulaye J. Dabo, Sonya Raghavan, Wendy Ezegbunam, Jincy Thankachen, Oleg Evgrafov, Sue Majka, Patrick Geraghty, Robert F. Foronjysphingomyelinase (NSMase) siRNA, PP2A siRNA or scrambled siRNA (Santa Cruz, Santa Cruz, CA, PTP1B- sc-36328, PP2A-C sc-43509, NSmase- sc-62655). Calcium release assay and calcium switch studies. Primary human

(2) A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent PathwayMolecular and Cellular BiologyDecember 20, 2023Olga Villamar-Cruz, Marco Antonio Loza-Mejía, Alonso Vivar-Sierra, Héctor Iván Saldivar-Cerón, Genaro Patiño-López, Jonadab Efraín Olguín, Luis Ignacio Terrazas, Leonel Armas-López, Federico Ávila-Moreno, Sayanti Saha, et al.aagatcggagagggcgcctttggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccaccccaaaggcgccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA). Cell culture Ptp1b−/− and Ptp1b+/+

(3) Protein Tyrosine Phosphatase 1B Deficiency in Vascular Smooth Muscle Cells Promotes Perivascular Fibrosis following Arterial InjuryThrombosis and haemostasisOctober 1, 2022Gogiraju R, Gachkar S, Velmeden D, Bochenek ML, Zifkos K, Hubert A, Münzel T, Offermanns S, Schäfer K.539741) or transfected with small-interfering RNA (siRNA) targeting PTP1B (Santa Cruz Biotechnology; sc-36328) or SMAD2 (ThermoFisher Scientific; Cat #AM16708) or with fluorescein-labeled control siRNA (Santa Cruz Biotechnology

(4) N-terminus-independent activation of c-Src via binding to a tetraspan(in) TM4SF5 in hepatocellular carcinoma is abolished by the TM4SF5 C-terminal peptide applicationTheranosticsJanuary 1, 2021Song HE, Lee Y, Kim E, Cho CY, Jung O, Lee D, Lee EG, Nam SH, Kang M, Macalino SJY, et al.

(5) Ion channel TRPV1-dependent activation of PTP1B suppresses EGFR-associated intestinal tumorigenesisThe Journal of clinical investigationSeptember 1, 2014de Jong PR, Takahashi N, Harris AR, Lee J, Bertin S, Jeffries J, Jung M, Duong J, Triano AI, Lee J, et al.

(6) The glutathione peroxidase 1-protein tyrosine phosphatase 1B-protein phosphatase 2A axis. A key determinant of airway inflammation and alveolar destructionAmerican journal of respiratory cell and molecular biologyNovember 1, 2013Geraghty P, Hardigan AA, Wallace AM, Mirochnitchenko O, Thankachen J, Arellanos L, Thompson V, D'Armiento JM, Foronjy RF.

(7) Effect of oxidative stress on protein tyrosine phosphatase 1B in scleroderma dermal fibroblastsArthritis and rheumatismJune 1, 2012Tsou PS, Talia NN, Pinney AJ, Kendzicky A, Piera-Velazquez S, Jimenez SA, Seibold JR, Phillips K, Koch AE.

(8) Liver-specific deletion of protein tyrosine phosphatase (PTP) 1B improves obesity- and pharmacologically induced endoplasmic reticulum stressThe Biochemical journalSeptember 1, 2011Agouni A, Mody N, Owen C, Czopek A, Zimmer D, Bentires-Alj M, Bence KK, Delibegović M.

Be the First to Write a Review!

PTP1B siRNA (h)

PTP1B siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (8)

Reviews

PTP1B siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map