IL-1α siRNA (m) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemIL-1α siRNA (m)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-39614
Quantity10 µM
Speciesmouse
TypesiRNA/dsRNA
NCBI Gene AliasesIl-1a
NCBI Full Gene Nameinterleukin 1 alpha
Gene Nameinterleukin 1, alpha

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) MiR-30a targets IL-1α and regulates islet functions as an inflammation buffer and response factorScientific reportsJuly 13, 2017Jiang X, Xu C, Lei F, Liao M, Wang W, Xu N, Zhang Y, Xie W.synthesized by Shanghai GenePharma Co. (Shanghai, China) (Supplementary Table S1). Il-1a siRNA [(m) sc-39614] was purchased from Santa Cruz Biotechnology, Inc., USA. miRNA mimics or siRNA duplexes with random

(2) miR-181a Regulates Inflammation Responses in Monocytes and MacrophagesPLoS ONEMarch 13, 2013Weidong Xie, Mengnan Li, Naihan Xu, Qing Lv, Nunu Huang, Jie He, Yaou ZhangNC,CAGUACUUUUGUGUAGUACAA siRNA NC,UUGUACUACACA AAAGUACUG siIL1a poor for mouse(Raw264.7 cells),"IL1a siRNA (m) sc-39614)(Santa Cruz Biotechnology, Inc.)" siIL1a poor for human(THP-1 cells),Si-1: ACUUGUUUAUUGCCACAAA ,Si-2:

Be the First to Write a Review!

IL-1α siRNA (m)

IL-1α siRNA (m) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (2)

Reviews

IL-1α siRNA (m) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map