HAI-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

(1) Exosomal miR-208b related with oxaliplatin resistance promotes Treg expansion in colorectal cancerMolecular TherapySeptember 1, 2021Tao Ning et al.upregulation, and an empty lentiviral vector was used as a negative control. A siRNA targeting PDCD4 (sc-39554, Santa Cruz Biotechnology) was used for PDCD4 downregulation, and a scrambled siRNA was used as a negative

(2) miR-221 and miR-222 synergistically regulate hepatocyte growth factor activator inhibitor type 1 to promote cell proliferation and migration in gastric cancerTumour biology : the journal of the International Society for Oncodevelopmental Biology and MedicineJune 1, 2017Ning T, Zhang H, Wang X, Li S, Zhang L, Deng T, Zhou L, Wang X, Liu R, Bai M, et al.empty lentiviral was used as a negative control. A small interfering RNA (siRNA) targeting human HAI-1 (sc-39554, Santa Cruz Biotechnology) was used for HAI-1 downregulation and a scrambled siRNA was used as a negative

(3) Novel Role for γ-Catenin in the Regulation of Cancer Cell Migration via the Induction of Hepatocyte Growth Factor Activator Inhibitor Type 1 (HAI-1)The Journal of biological chemistryJune 19, 2015Sechler M, Borowicz S, Van Scoyk M, Avasarala S, Zerayesus S, Edwards MG, Kumar Karuppusamy Rathinam M, Zhao X, Wu PY, Tang K, et al.(CCCUCGUGCAGAUCAUGCGUAACUA) were procured from Invitrogen. Control siRNA (sc-37007), p53 siRNA (sc-29435), and HAI-1 siRNA (sc-39554) were purchased from Santa Cruz Biotechnology. NSCLC cells were treated with 50 nm siRNAs by using Lipofectamine

HAI-1 siRNA (h)