E2F-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemE2F-1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29297
Gene NameE2F transcription factor 1
Quantity10 µM
Specieshuman
NCBI Full Gene NameE2F transcription factor 1
NCBI Gene AliasesE2F-1, RBAP1, RBBP3, RBP3
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) CDK8 Inhibition Increases E2F1 Transcriptional Activity and Promotes STAT3-Dependent Suppression of Mcl-1 in Triple-Negative Breast Cancer Cell Line MDA-MB-468International Journal of Molecular SciencesJanuary 16, 2026Sandra Do, Shengxi Li, Rui Xiong, Jensen M. Spear, Zhixin Lu, William K. Chan, Wade A. RussuCells were maintained as a monolayer at 37 °C and 5% CO2. Control siRNA-B (sc-44230), E2F-1 siRNA (h) (sc-29297), Cdk8 siRNA (h) (sc-29267), siRNA Transfection Medium (sc-36868) and siRNA Transfection Reagent (sc-29528),

(2) "Nuclear translocation of an aminoacyl-tRNA synthetase may mediate a chronic ""integrated stress response"""Cell reportsJune 27, 2023Jones JA, Wei N, Cui H, Shi Y, Fu G, Rauniyar N, Shapiro R, Morodomi Y, Berenst N, Dumitru CD, et al.

(3) Docetaxel Enhances Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Mediated Apoptosis in Prostate Cancer Cells via Epigenetic Gene Regulation by Enhancer of Zeste Homolog 2The World Journal of Men's HealthJanuary 1, 2023Won Hyeok Lee, Seong Cheol Kim, Song Hee Kim, Ji Hyung Yoon, Kyung Hyun Moon, Sang Hyeon Cheon, Taekmin Kwon, Young Min Kim, Jeong Woo Park, Sang Hun Lee, et al.Scientific), following the manufacturer’s protocol. Small interfering RNA (siRNA) against human E2F1 (siE2F1) (sc-29297) and control siRNA (scRNA) (sc-37007) were purchased from Santa Cruz Biotechnology. DU145 cells (1.5

(4) G6PD-mediated increase in de novo NADP(+) biosynthesis promotes antioxidant defense and tumor metastasisScience advancesJuly 22, 2022Zhang Y, Xu Y, Lu W, Li J, Yu S, Brown EJ, Stanger BZ, Rabinowitz JD, Yang X.

(5) Targeted CUL4A inhibition synergizes with cisplatin to yield long-term survival in models of head and neck squamous cell carcinoma through a DDB2-mediated mechanismCell death & diseaseApril 15, 2022Jones TM, Espitia CM, Ooi A, Bauman JE, Carew JS, Nawrocki ST.

(6) Positive regulation of ataxia-telangiectasia-mutated protein (ATM) by E2F transcription Factor 1 (E2F-1) in cisplatin-resistant nasopharyngeal carcinoma cellsWorld journal of surgical oncologyMarch 18, 2022Zhou ZY, Yang JY, Shao CZ, Luo F, Du W.Santa Cruz Biotechnology, USA), E2F-1 shRNA#2 group (cells were transfected with E2F-1 shRNA plasmids, sc-29297, Santa Cruz Biotechnology, USA), ATM group (cells were transfected with ATM lentiviral activation particles,

(7) Circular RNA circ-FoxO3 attenuates blood-brain barrier damage by inducing autophagy during ischemia/reperfusionMolecular therapy : the journal of the American Society of Gene TherapyMarch 2, 2022Yang Z, Huang C, Wen X, Liu W, Huang X, Li Y, Zang J, Weng Z, Lu D, Tsang CK, et al.the Gel-Imaging System (Tanon 4600, Shanghai, China). The siE2F1 (Santa Cruz, sc-35247; Santa Cruz, sc-29297) was used to interfere with E2F1 in BMECs. TEM Autophagic vacuoles in brain tissues or BMECs were

(8) Anti-Proliferative Effects of E2F1 Suppression in Glioblastoma CellsCytogenetic and genome researchJanuary 1, 2021Godoy PRDV, Donaires FS, Montaldi APL, Sakamoto-Hojo ET.

(9) Pharmacological Inhibition of CDK8 in Triple-Negative Breast Cancer Cell Line MDA-MB-468 Increases E2F1 Protein, Induces Phosphorylation of STAT3 and ApoptosisMolecules (Basel, Switzerland)December 4, 2020Spear JM, Lu Z, Russu WA.

(10) ERINA Is an Estrogen-Responsive LncRNA That Drives Breast Cancer through the E2F1/RB1 PathwayCancer researchOctober 15, 2020Fang Z, Wang Y, Wang Z, Xu M, Ren S, Yang D, Hong M, Xie W.from H. Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA. The siRNAs of E2F1 (sc-29297) and RB (sc-29468) were purchased from Santa Cruz. Luciferase reporter assay The E2F1 responsive 3x-E2F-Luc

(11) The carcinogen cadmium elevates CpG-demethylation and enrichment of NFYA and E2F1 in the promoter of oncogenic PRMT5 and EZH2 methyltransferases resulting in their elevated expression in vitroChemosphereMarch 1, 2020Ghosh K, Chatterjee B, Behera P, Kanade SR.

(12) An E2F1/DDX11/EZH2 Positive Feedback Loop Promotes Cell Proliferation in Hepatocellular CarcinomaFrontiers in oncologyJanuary 1, 2020Su SG, Li QL, Zhang MF, Zhang PW, Shen H, Zhang CZ.then selected by G418 for two weeks. siRNAs targeting p21 (#6456, Cell Signaling Technology), E2F1 (sc-29297, Santa-cruz Biotechnology), E2F2 (sc-29298, Santa-cruz Biotechnology), E2F3 (sc-37817, Santa-cruz Biotechnology),

(13) EZH2 cooperates with E2F1 to stimulate expression of genes involved in adrenocortical carcinoma aggressivenessBritish journal of cancerAugust 1, 2019Tabbal H, Septier A, Mathieu M, Drelon C, Rodriguez S, Djari C, Batisse-Lignier M, Tauveron I, Pointud JC, Sahut-Barnola I, et al.were: siGFP: ACUACCAGCAGAACACCCCUU; siEZH2: Silencer Select (s4917, Ambion Life Technologies); siE2F1 (sc-29297, Santa Cruz Biotechnology) and siRRM2 (106532, Thermofisher). For pharmacological RRM2 inhibition, H295R

(14) PTEN Inhibition Protects Against Experimental Intracerebral Hemorrhage-Induced Brain Injury Through PTEN/E2F1/β-Catenin PathwayFrontiers in molecular neuroscienceJanuary 1, 2019Zhao D, Qin XP, Chen SF, Liao XY, Cheng J, Liu R, Lei Y, Zhang ZF, Wan Q.China, GOSE91553) as in our previous study (Chen et al., 2016). PTEN siRNA (sc-29459), E2F1 siRNA (sc-29297), and control siRNA (sc-44236) were purchased from Santa Cruz Biotechnology. The treatment was performed

(15) Regulation of Sox2 and stemness by nicotine and electronic-cigarettes in non-small cell lung cancerMolecular cancerOctober 15, 2018Schaal CM, Bora-Singhal N, Kumar DM, Chellappan SP.Santa Cruz Biotechnology including Oct3/4 (sc36123), TEF4/Tead2 (sc45232), α7 nAChR (sc42532), E2F1 (sc29297), c-Src (sc44250), Sox2 (sc38408), Yap1 (sc38637), c-Yes (sc29860), and β-arr-1 (sc29741). Antibodies

(16) TGF-β induces growth suppression in multiple myeloma MM.1S cells via E2F1Oncology lettersAugust 1, 2017Liu X, Guo H, Wei Y, Cai C, Zhang B, Li J.medium supplemented with FBS. Cells were transiently transfected with siRNAs against E2F1 (cat. no. sc‑29297) or control siRNA (cat. no. sc‑37007; both from Santa Cruz Biotechnology, Inc., Dallas, TX, USA), according

(17) Role of integrin-linked kinase in regulating the protein stability of the MUC1-C oncoprotein in pancreatic cancer cellsOncogenesisJuly 10, 2017Huang HL, Wu HY, Chu PC, Lai IL, Huang PH, Kulp SK, Pan SL, Teng CM, Chen CS.

(18) HDAC4 and HDAC6 sustain DNA double strand break repair and stem-like phenotype by promoting radioresistance in glioblastoma cellsCancer lettersJuly 1, 2017Marampon F, Megiorni F, Camero S, Crescioli C, McDowell HP, Sferra R, Vetuschi A, Pompili S, Ventura L, De Felice F, et al.

(19) CREB1 directly activates the transcription of ribonucleotide reductase small subunit M2 and promotes the aggressiveness of human colorectal cancerOncotargetNovember 22, 2016Fang Z, Lin A, Chen J, Zhang X, Liu H, Li H, Hu Y, Zhang X, Zhang J, Qiu L, et al.

(20) LXR agonist regulates the proliferation and apoptosis of human T-Cell acute lymphoblastic leukemia cells via the SOCS3 pathwayThe international journal of biochemistry & cell biologySeptember 1, 2016Zhang R, Liu Z, Li Y, Wu B.

Be the First to Write a Review!

E2F-1 siRNA (h)

E2F-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (56)

Reviews

E2F-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map