HoxB13 siRNA (h) from Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

(1) H3K27 acetylation activated-long non-coding RNA CCAT1 affects cell proliferation and migration by regulating SPRY4 and HOXB13 expression in esophageal squamous cell carcinomaNucleic acids researchApril 7, 2017Zhang E, Han L, Yin D, He X, Hong L, Si X, Qiu M, Xu T, De W, Xu L, et al.and SUV39H1 were acquired according to previous study (33,55). The HOXB13 siRNA was from Santa Cruz (sc-43851). The shCCAT1 (AAGCAGGCAGAAAGCCGUAUCUUAA) was cloned into pENTR™/U6 vector. LNA-ASO targeting CCAT1

(2) HOXB13 contributes to G1/S and G2/M checkpoint controls in prostateMolecular and cellular endocrinologyMarch 5, 2014Hamid SM, Cicek S, Karamil S, Ozturk MB, Debelec-Butuner B, Erbaykent-Tepedelen B, Varisli L, Gonen-Korkmaz C, Yorukoglu K, Korkmaz KS.

HoxB13 siRNA (h)