Cbl siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemCbl siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29242
Gene NameCas-Br-M (murine) ecotropic retroviral transforming sequence
Quantity10 µM
Specieshuman
NCBI Full Gene NameCbl proto-oncogene
NCBI Gene AliasesC-CBL, CBL2, FRA11B, NSLL, RNF55
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Licochalcone A Promotes the Ubiquitination of c-Met to Abrogate Gefitinib ResistanceBioMed research internationalJanuary 1, 2022Han S, Li X, Gan Y, Li W.colonies were chosen for further study. For transient transfection, the siRNAs, including si-c-Cbl (sc-29242) and siCtrl (sc-37001), were purchased from Santa Cruz Biotechnology (Dallas, TX). The c-Met cDNA (RC217003)

(2) Composition of receptor tyrosine kinase-mediated lipid micro-domains controlled by adaptor protein interactionScientific reportsMarch 17, 2021Rohwedder A, Knipp S, Roberts LD, Ladbury JE.

(3) Neddylation of PTEN regulates its nuclear import and promotes tumor developmentCell researchMarch 1, 2021Xie P, Peng Z, Chen Y, Li H, Du M, Tan Y, Zhang X, Lu Z, Cui CP, Liu CH, et al.

(4) Dexamethasone Inhibits TRAIL-Induced Apoptosis through c-FLIP(L) Upregulation and DR5 Downregulation by GSK3β Activation in Cancer CellsCancersOctober 9, 2020Jeon MY, Woo SM, Seo SU, Kim SH, Nam JO, Kim S, Park JW, Kubatka P, Min KJ, Kwon TK.

(5) Upregulation of DR5 and Downregulation of Survivin by IITZ-01, Lysosomotropic Autophagy Inhibitor, Potentiates TRAIL-Mediated Apoptosis in Renal Cancer Cells via Ubiquitin-Proteasome PathwayCancersAugust 21, 2020Shahriyar SA, Seo SU, Min KJ, Kubatka P, Min DS, Chang JS, Kim DE, Woo SM, Kwon TK.

(6) Cerebral arteriopathy associated with heterozygous variants in the casitas B-lineage lymphoma geneNeurology. GeneticsAugust 1, 2020Hong Y, Keylock A, Jensen B, Jacques TS, Ogunbiyi O, Omoyinmi E, Saunders D, Mallick AA, Tooley M, Newbury-Ecob R, et al.fibroblasts (HDFCs and HBVAFs) or HUVECs via transient transfection using with 100 nM of siRNA targeting CBL (SC-29242; Santa Cruz) or a negative control. siRNAs (SC-37007; Santa Cruz) were transfected via complexation

(7) Differential protein stability of EGFR mutants determines responsiveness to tyrosine kinase inhibitorsOncotargetOctober 18, 2016Ray P, Tan YS, Somnay V, Mehta R, Sitto M, Ahsan A, Nyati S, Naughton JP, Bridges A, Zhao L, et al.

(8) A combination of two antibodies recognizing non-overlapping epitopes of HER2 induces kinase activity-dependent internalization of HER2Journal of cellular and molecular medicineOctober 1, 2016Szymanska M, Fosdahl AM, Nikolaysen F, Pedersen MW, Grandal MM, Stang E, Bertelsen V.recommendations. For siRNA‐mediated knock down of Cbl, a combination of Cbl‐b (sc 29950) and c‐Cbl (sc 29242) siRNA, both from Santa Cruz Biotechnology, Inc., was used. For knock down of clathrin heavy chain,

(9) C3G forms complexes with Bcr-Abl and p38α MAPK at the focal adhesions in chronic myeloid leukemia cells: implication in the regulation of leukemic cell adhesionCell communication and signaling : CCSJanuary 23, 2013Maia V, Ortiz-Rivero S, Sanz M, Gutierrez-Berzal J, Alvarez-Fernández I, Gutierrez-Herrero S, de Pereda JM, Porras A, Guerrero C.

(10) Cargo-dependent degradation of ESCRT-I as a feedback mechanism to modulate endosomal sortingTraffic (Copenhagen, Denmark)September 1, 2011Malerød L, Pedersen NM, Sem Wegner CE, Lobert VH, Leithe E, Brech A, Rivedal E, Liestøl K, Stenmark H.

(11) Interaction of c-Cbl with myosin IIA regulates Bleb associated macropinocytosis of Kaposi's sarcoma-associated herpesvirusPLoS pathogensDecember 23, 2010Valiya Veettil M, Sadagopan S, Kerur N, Chakraborty S, Chandran B.

(12) Endocytosis of the anthrax toxin is mediated by clathrin, actin and unconventional adaptorsPLoS pathogensMarch 5, 2010Laurence Abrami, Mirko Bischofberger, Béatrice Kunz, Romain Groux, F Gisou van der GootAAGGACCGCAAAGTGTTTGTG, DAB2: AAGGTTGGCCTTAGTAGTCAA, were purchased from Qiagen. Cbl siRNA was purchased from Santa Cruz (sc-29242). As control siRNA we used the following target sequence of the viral glycoprotein VSV-G: ATTGAACAAACGAAACAAGGA.

(13) Ubiquitination of fibroblast growth factor receptor 1 is required for its intracellular sorting but not for its endocytosisMolecular biology of the cellAugust 1, 2008Haugsten EM, Malecki J, Bjørklund SM, Olsnes S, Wesche J.

(14) Signal-transducing adaptor protein-2 regulates integrin-mediated T cell adhesion through protein degradation of focal adhesion kinaseJournal of immunology (Baltimore, Md. : 1950)August 15, 2007Sekine Y, Tsuji S, Ikeda O, Sugiyma K, Oritani K, Shimoda K, Muromoto R, Ohbayashi N, Yoshimura A, Matsuda T.Jurkat/STAP-2 cells (4 ⫻ 106) were nucleofected with control or Cbl siRNA (Santa Cruz Biotechnology; SC-29242) using the Cell Line Nucleofector Kit V (Amaxa Biosystems). Thirty-six hours after transfection, cells

(15) Spred-2 steady-state levels are regulated by phosphorylation and Cbl-mediated ubiquitinationBiochemical and biophysical research communicationsDecember 29, 2006Lock P, I ST, Straffon AF, Schieb H, Hovens CM, Stylli SS.

Be the First to Write a Review!

Cbl siRNA (h)

Cbl siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (15)

Reviews

Cbl siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map