caveolin-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
Itemcaveolin-1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29241
Gene Namecaveolin 1, caveolae protein, 22kDa
Quantity10 µM
Specieshuman
NCBI Full Gene Namecaveolin 1
NCBI Gene AliasesBSCL3, CGL3, LCCNS, MSTP085, PPH3, VIP21
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Fatty acid uptake activates an AXL–CAV1–β-catenin axis to drive melanoma progressionGenes & DevelopmentApril 1, 2025Ana Chocarro-Calvo, Miguel Jociles-Ortega, José Manuel García-Martinez, Pakavarin Louphrasitthiphol, Sofia Carvalho-Marques, Yurena Vivas-García, Ana Ramírez-Sánchez, Jagat Chauhan, M. Carmen Fiuza, Manuel Druan, et al.5′–3′: GCCTCACTAAACCATCCAATCG,Sigma Aldrich,This study, siRNA human Caveolin-1,Santa Cruz Biotechnology,SC-29241, SMARTpool: On-TargetPlus SRC siRNA,"Dharmacon, Inc.",L-003175-00-0005, siRNA β-catenin r(UCCAUUCUGGUGCCACCAC)d(TT)

(2) Caveolin-1 knockout mitigates breast cancer metastasis to the lungs via integrin α3 dysregulation in 4T1-induced syngeneic breast cancer modelCancer Gene TherapyNovember 1, 2024Dhirendra Pratap Singh, Rashmi Pathak, Naveen Chintalaramulu, Abhishek Pandit, Avinash Kumar, Philip J. Ebenezer, Sanjay Kumar, Alexander Duplooy, Mary Evelyn White, Nithya Jambunathan, et al.h. These findings were confirmed in the MDA-MB-231 human cell line using human siRNA for Cav1 (Cat#sc-29241) and integrin α3/ITGA3/CD49c (Cat#sc-63319) (Santa Cruz Biotechnology, Inc). Control siRNA-A (sc-37007)

(3) Miriplatin-loaded liposome, as a novel mitophagy inducer, suppresses pancreatic cancer proliferation through blocking POLG and TFAM-mediated mtDNA replicationActa Pharmaceutica Sinica BNovember 1, 2023Xiaowei Wang, Mengyan Wang, Meilian Cai, Rongguang Shao, Guimin Xia, Wuli Zhao(Beijing, China). Small interfering RNA (siRNA): clathrin HC siRNA (h) (sc-35067) and caveolin-1 siRNA (h) (sc-29241) were purchased from Santa Cruz (California, USA). si-h-POLG_101 (siG000005428A-1–5) and si-h-TFAM_001

(4) A universal method to analyze cellular internalization mechanisms via endocytosis without non-specific cross-effectsFASEB journal : official publication of the Federation of American Societies for Experimental BiologyFebruary 1, 2023Itagaki M, Nasu Y, Sugiyama C, Nakase I, Kamei N.

(5) Substrate Stiffness-Driven Membrane Tension Modulates Vesicular Trafficking via Caveolin-1ACS nanoMarch 22, 2022Lachowski D, Matellan C, Gopal S, Cortes E, Robinson BK, Saiani A, Miller AF, Stevens MM, Del Río Hernández AE.transfected with 7.5 pmol of scramble control siRNA-A (sc-37007, Santa Cruz Biotechnology), caveolin-1 siRNA (sc-29241, Santa Cruz Biotechnology), and dynamin-2 siRNA (sc-35236, Santa Cruz Biotechnology) using Lipofectamine 3000

(6) E-cig vapor condensate alters proteome and lipid profiles of membrane rafts: impact on inflammatory responses in A549 cellsCell biology and toxicologyOctober 1, 2021Singh DP, Begum R, Kaur G, Bagam P, Kambiranda D, Singh R, Batra S.

(7) Transport mechanism and subcellular localization of a polysaccharide from Cucurbia Moschata across Caco-2 cells modelInternational journal of biological macromoleculesJuly 1, 2021Li F, Wei Y, Zhao J, Yu G, Huang L, Li Q.

(8) The Gb3-enriched CD59/flotillin plasma membrane domain regulates host cell invasion by Pseudomonas aeruginosaCellular and molecular life sciences : CMLSApril 1, 2021Brandel A, Aigal S, Lagies S, Schlimpert M, Meléndez AV, Xu M, Lehmann A, Hummel D, Fisch D, Madl J, et al.purchased from Dharmacon, Horizon Discovery. The siRNA against caveolin-1 was from Santa Cruz (Cat. No. sc-29241). During the incubation with a mixture of siRNA and Lipofectamine 2000, cells were kept in Opti-MEM

(9) Porcine Circovirus Type 3 Enters Into PK15 Cells Through Clathrin- and Dynamin-2-Mediated Endocytosis in a Rab5/Rab7 and pH-Dependent FashionFrontiers in microbiologyJanuary 1, 2021Shi R, Hou L, Wei L, Quan R, Zhou B, Jiang H, Wang J, Zhu S, Song J, Wang D, et al.the manufacturer’s instructions. The siRNAs targeting CLTC (siCLTC, sc-35067), caveolin-1 (siCav1, sc-29241), Rab5 (siRab5, sc-36344), Rab7 (siRab7, sc-29460), and siRNA with a control sequence (siCtrl, sc-37007)

(10) A novel TRPM7/O-GlcNAc axis mediates tumour cell motility and metastasis by stabilising c-Myc and caveolin-1 in lung carcinomaBritish journal of cancerOctober 1, 2020Luanpitpong S, Rodboon N, Samart P, Vinayanuwattikun C, Klamkhlai S, Chanvorachote P, Rojanasakul Y, Issaragrisil S.

(11) Intact caveolae are required for proper extravillous trophoblast migration and differentiationJournal of cellular physiologyApril 1, 2020Reppetti J, Reca A, Seyahian EA, Medina Y, Martínez N, Szpilbarg N, Damiano AE.

(12) Transport Mechanisms of Polymannuronic Acid and Polyguluronic Acid Across Caco-2 Cell MonolayersPharmaceuticsFebruary 17, 2020Wang Y, Bai X, Hu B, Xing M, Cao Q, Ji A, Song S.anti-dynamin II monoclonal antibody (sc-166669), dynamin II siRNA (h) (sc-35236), and caveolin-1 siRNA (h) (sc-29241) were purchased from Santa Cruz (Dallas, Texas, USA). Rabbit anti-claudin-1(WL00448) and rabbit anti-occludin

(13) MiR-124-3p.1 Sensitizes Ovarian Cancer Cells to Mitochondrial Apoptosis Induced by CarboplatinOncoTargets and therapyJanuary 1, 2020Deng X, Chen Y, Liu Z, Xu J.

(14) MicroRNA‑192 inhibits cell proliferation and induces apoptosis in human breast cancer by targeting caveolin 1Oncology reportsNovember 1, 2019Chen P, Feng Y, Zhang H, Shi X, Li B, Ju W, Yu X, Zhang N, Luo X.

(15) Caveolin-1 Regulates P2Y(2) Receptor Signaling during Mechanical Injury in Human 1321N1 AstrocytomaBiomoleculesOctober 18, 2019Martínez M, Martínez NA, Miranda JD, Maldonado HM, Silva Ortiz WI.was obtained from Tocris Bioscience (Ellisville, MO, USA). Control (SC108080) and human caveolin-1 (SC29241) shRNA lentiviral particles were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). All

(16) Endocytosis of flavivirus NS1 is required for NS1-mediated endothelial hyperpermeability and is abolished by a single N-glycosylation site mutationPLoS pathogensJuly 1, 2019Wang C, Puerta-Guardo H, Biering SB, Glasner DR, Tran EB, Patana M, Gomberg TA, Malvar C, Lo NTN, Espinosa DA, et al.Control siRNA-A (sc-37007), Clathrin HC siRNA (h) (sc-35067), Dynamin I/II (sc-43736), and caveolin-1 siRNA (h) (sc-29241) were resuspended in siRNA Dilution Buffer (sc-29527) according to the manufacturer’s instructions.

(17) Peroxisome Proliferator-Activated Receptor γ Agonist Rosiglitazone Protects Blood-Brain Barrier Integrity Following Diffuse Axonal Injury by Decreasing the Levels of Inflammatory Mediators Through a Caveolin-1-Dependent PathwayInflammationJune 1, 2019Zhao Y, Wei X, Song J, Zhang M, Huang T, Qin J.

(18) Structural and Functional Determinants of AC8 Trafficking, Targeting and Responsiveness in Lipid Raft MicrodomainsThe Journal of membrane biologyJune 1, 2019Tabbasum VG, Cooper DMF.

(19) Inducible Knockdown of Endothelial Protein Tyrosine Phosphatase-1B Promotes Neointima Formation in Obese Mice by Enhancing Endothelial SenescenceAntioxidants & redox signalingMarch 1, 2019Jäger M, Hubert A, Gogiraju R, Bochenek ML, Münzel T, Schäfer K.

(20) Absence of Cytosolic 2-Cys Prx Subtypes I and II Exacerbates TNF-α-Induced Apoptosis via Different RoutesCell reportsFebruary 19, 2019Lee S, Lee JY, Lee EW, Park S, Kang DH, Min C, Lee DJ, Kang D, Song J, Kwon J, et al.