ATF-4 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemATF-4 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-35112
Gene Nameactivating transcription factor 4
Quantity10 µM
Specieshuman
NCBI Full Gene Nameactivating transcription factor 4
NCBI Gene AliasesCREB-2, CREB2, TAXREB67, TXREB
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Inhibition of the Integrated stress response by Epstein-Barr virus oncoprotein LMP1 attenuates epithelial cell differentiation and lytic viral reactivationPLoS PathogFebruary 14, 2025Deo R. Singh, Yitao Zhang, Sophia J. White, Scott E. Nelson, Stuart A. Fogarty, Abigail S. Pawelski, Alisha S. Kansra, Shannon C. Kenneyanalysis. siRNAs siRNAs against KLF4 (sc-35437), BLIMP1 (sc-37714), PERK (sc-36213), GCN2 (sc-45644), ATF4 (sc-35112), and control siRNAs A and C (sc-37007, sc-44230) were purchased from Santa Cruz. For the CHOP siRNA

(2) Akt enhances the vulnerability of cancer cells to VCP/p97 inhibition-mediated paraptosisCell death & diseaseJanuary 13, 2024Lee DM, Kim IY, Lee HJ, Seo MJ, Cho MY, Lee HI, Yoon G, Ji JH, Park SS, Jeong SY, et al.Invitrogen. siATF4 (target sequences: CCACUCCAGAUCAUUCCUU, GGAUAUCACUGAAGGAGAU, and GUGAGAAACUGGAUAAGAA, sc-35112) was obtained from Santa Cruz. The siRNA oligonucleotides were annealed and transfected into cells using

(3) Co-inhibition of glutaminolysis and one-carbon metabolism promotes ROS accumulation leading to enhancement of chemotherapeutic efficacy in anaplastic thyroid cancerCell Death & DiseaseAugust 12, 2023Yeseong Hwang, Hyeok Jun Yun, Jae Woong Jeong, Minki Kim, Seyeon Joo, Hae-Kyung Lee, Hang-Seok Chang, Seok-Mo Kim, Sungsoon FangRNA (siCTRL and siATF4) oligonucleotides were purchased from Santa Cruz Biotechnology (sc-37007 and sc-35112, respectively). Cell culture and treatment 8505 C cells obtained from the European Collection of Authenticated

(4) The stress sensor GCN2 differentially controls ribosome biogenesis in colon cancer according to the nutritional contextMolecular oncologyJuly 15, 2023Piecyk M, Triki M, Laval PA, Duret C, Fauvre J, Cussonneau L, Machon C, Guitton J, Rama N, Gibert B, et al.

(5) Dual inhibition of thioredoxin reductase and proteasome is required for auranofin-induced paraptosis in breast cancer cellsCell death & diseaseJanuary 19, 2023Seo MJ, Kim IY, Lee DM, Park YJ, Cho MY, Jin HJ, Choi KS.Santa Cruz: siATF4 (target sequence CCACUCCAGAUCAUUCCUU, GGAUAUCACUGAAGGAGAU, and GUGAGAAACUGGAUAAGAA, sc-35112). CHOP (DDIT3) targeted siRNA was synthesized from Invitrogen: siCHOP (target sequence GAGCUCUGAUUGACCGAAUGGUGAA).

(6) UPR(mt) activation improves pathological alterations in cellular models of mitochondrial diseasesOrphanet journal of rare diseasesMay 17, 2022Suárez-Rivero JM, Pastor-Maldonado CJ, Povea-Cabello S, Álvarez-Córdoba M, Villalón-García I, Talaverón-Rey M, Suárez-Carrillo A, Munuera-Cabeza M, Reche-López D, Cilleros-Holgado P, et al.

(7) Endoplasmic reticulum stress downregulates PGC-1α in skeletal muscle through ATF4 and an mTOR-mediated reduction of CRTC2Cell communication and signaling : CCSApril 15, 2022Montori-Grau M, Aguilar-Recarte D, Zarei M, Pizarro-Delgado J, Palomer X, Vázquez-Carrera M.

(8) ISRIB plus bortezomib triggers paraptosis in breast cancer cells via enhanced translation and subsequent proteotoxic stressBiochemical and biophysical research communicationsMarch 12, 2022Lee DM, Seo MJ, Lee HJ, Jin HJ, Choi KS.

(9) Advanced single-cell pooled CRISPR screening identifies C19orf53 required for cell proliferation based on mTORC1 regulatorsCell biology and toxicologyFebruary 1, 2022Tang Y, Liao S, Liu G, Xiong X, Liu H, Li F, Tan Z, Kong X, Yin Y, Tan B.

(10) Endoplasmic reticulum stress inhibits AR expression via the PERK/eIF2α/ATF4 pathway in luminal androgen receptor triple-negative breast cancer and prostate cancerNPJ breast cancerJanuary 10, 2022Li X, Zhou D, Cai Y, Yu X, Zheng X, Chen B, Li W, Zeng H, Hassan M, Zhao Y, et al.

(11) Salubrinal induces fetal hemoglobin expression via the stress-signaling pathway in human sickle erythroid progenitors and sickle cell disease micePloS oneJanuary 1, 2022Lopez NH, Li B, Palani C, Siddaramappa U, Takezaki M, Xu H, Zhi W, Pace BS.summary of primer sequences is shown in S1 Table. ATF4 gene silencing was achieved using ATF4 siRNA (SC-35112, Santa Cruz Biotechnology) (200 nM) to transfect K562 cells for 24 h using the Dharmafect 1 system;

(12) Amino acid deprivation induces AKT activation by inducing GCN2/ATF4/REDD1 axisCell death & diseaseDecember 3, 2021Jin HO, Hong SE, Kim JY, Jang SK, Park IC.wild-type ATF4 (pEF/mATF4-myc) was kindly provided by Dr. Jawed Alam [30]. GCN2 (#sc-45644), ATF4 (#sc-35112), REDD1 (#sc-45806), Rictor (#sc-61478), Sin1 (#sc-60984) and control (#sc-37007) siRNAs were purchased

(13) Inhibition of mTORC1 through ATF4-induced REDD1 and Sestrin2 expression by MetforminBMC cancerJuly 12, 2021Jang SK, Hong SE, Lee DH, Kim JY, Kim JY, Ye SK, Hong J, Park IC, Jin HO.

(14) Activation of ATF4 triggers trabecular meshwork cell dysfunction and apoptosis in POAGAgingMarch 10, 2021Ying Y, Xue R, Yang Y, Zhang SX, Xiao H, Zhu H, Li J, Chen G, Ye Y, Yu M, et al.

(15) P53-independent partial restoration of the p53 pathway in tumors with mutated p53 through ATF4 transcriptional modulation by ERK1/2 and CDK9Neoplasia (New York, N.Y.)March 1, 2021Tian X, Ahsan N, Lulla A, Lev A, Abbosh P, Dicker DT, Zhang S, El-Deiry WS.

(16) The acute transcriptional responses to dietary methionine restriction are triggered by inhibition of ternary complex formation and linked to Erk1/2, mTOR, and ATF4Scientific reportsFebruary 12, 2021Stone KP, Ghosh S, Kovalik JP, Orgeron M, Wanders D, Sims LC, Gettys TW.

(17) Head and Neck Cancer Cell Death due to Mitochondrial Damage Induced by Reactive Oxygen Species from Nonthermal Plasma-Activated Media: Based on Transcriptomic AnalysisOxidative medicine and cellular longevityJanuary 1, 2021Oh C, Won HR, Kang WS, Kim DW, Jung SN, Im MA, Liu L, Jin YL, Piao Y, Kim HJ, et al.Lipofectamine RNAi MAX reagent (Invitrogen). Negative siRNA was used as a negative control. ATF-4 siRNA (sc-35112, Santa Cruz Biotechnology, Santa Cruz, CA, USA) was a pool of three unique siRNA duplexes with the following

(18) NLRP1 Functions Downstream of the MAPK/ERK Signaling via ATF4 and Contributes to Acquired Targeted Therapy Resistance in Human Metastatic MelanomaPharmaceuticals (Basel, Switzerland)December 30, 2020Zhai Z, Vaddi PK, Samson JM, Takegami T, Fujita M.

(19) Magnolol Enhances the Therapeutic Effects of TRAIL through DR5 Upregulation and Downregulation of c-FLIP and Mcl-1 Proteins in Cancer CellsMolecules (Basel, Switzerland)October 8, 2020Woo SM, Min KJ, Kwon TK.

(20) Targeting CLK3 inhibits the progression of cholangiocarcinoma by reprogramming nucleotide metabolismThe Journal of experimental medicineAugust 3, 2020Zhou Q, Lin M, Feng X, Ma F, Zhu Y, Liu X, Qu C, Sui H, Sun B, Zhu A, et al.