Mfn2 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemMfn2 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-43928
Gene Namemitofusin 2
Quantity10 µM
Specieshuman
NCBI Full Gene Namemitofusin 2
NCBI Gene AliasesCMT2A, CMT2A2, CMT2A2A, CMT2A2B, CPRP1, HMSN6A, HSG, MARF, MSL
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Decorin evokes reversible mitochondrial depolarization in carcinoma and vascular endothelial cellsAmerican journal of physiology. Cell physiologyNovember 1, 2022Neill T, Xie C, Iozzo RV.

(2) Caveolin-1 controls mitochondrial damage and ROS production by regulating fission - fusion dynamics and mitophagyRedox biologyJune 1, 2022Jiang Y, Krantz S, Qin X, Li S, Gunasekara H, Kim YM, Zimnicka A, Bae M, Ma K, Toth PT, et al.

(3) Mitofusin-2 stabilizes adherens junctions and suppresses endothelial inflammation via modulation of β-catenin signalingNature communicationsMay 12, 2021Kim YM, Krantz S, Jambusaria A, Toth PT, Moon HG, Gunarathna I, Park GY, Rehman J.Center for Cancer Biology, VIB, Leuven, Belgium. We obtained siRNA for beta-catenin (sc-29209), Mfn2 (sc-43928), Mfn1 (sc-43927), Drp1 (sc-43732), Opa1(sc-106808) or control (sc-37007) from Santa Cruz Biotechnologies. Lentivirus

(4) Actin cables and comet tails organize mitochondrial networks in mitosisNatureMarch 1, 2021Moore AS, Coscia SM, Simpson CL, Ortega FE, Wait EC, Heddleston JM, Nirschl JJ, Obara CJ, Guedes-Dias P, Boecker CA, et al.sc-37330), Spire1C (Dharmacon, CCUAGGAUAACCAGUGUAUUU), MFN1 (Santa Cruz, sc-43927), MFN2 (Santa Cruz, sc-43928). Cell culture HeLa-M (A.Peden, Cambridge, UK), HaCaT (ATCC), COS-7 (ATCC), ARPE19 (ATCC), HEK293T

(5) The Causal Role of Mitochondrial Dynamics in Regulating Innate Immunity in DiabetesFrontiers in endocrinologyJanuary 1, 2020Chang YH, Lin HY, Shen FC, Su YJ, Chuang JH, Lin TK, Liou CW, Lin CY, Weng SW, Wang PW.mock control (Technologies, Inc., Rockville, MD, USA). For siRNA knockdown, interfering RNAs (sc-43927; sc-43928; sc-43732; sc-60643; Santa Cruz Biotechnology, Santa Cruz, CA) were delivered using Lipofectamine R

(6) Vascular progenitor cell senescence in patients with Marfan syndromeJournal of cellular and molecular medicineJune 1, 2019He H, Yu B, Liu Z, Ye G, You W, Hong Y, Lian Q, Zhang Y, Li X.

(7) Myoglobin induces mitochondrial fusion, thereby inhibiting breast cancer cell proliferationThe Journal of biological chemistryMay 3, 2019Braganza A, Quesnelle K, Bickta J, Reyes C, Wang Y, Jessup M, St Croix C, Arlotti J, Singh SV, Shiva S.

(8) FGF21 Mediates Mesenchymal Stem Cell Senescence via Regulation of Mitochondrial DynamicsOxidative medicine and cellular longevityJanuary 1, 2019Li X, Hong Y, He H, Jiang G, You W, Liang X, Fu Q, Han S, Lian Q, Zhang Y.Small-Interfering RNA (siRNA) Silencing. FGF21 siRNA (Santa Cruz, sc-39484), Mfn2 siRNA (Santa Cruz, SC43928), and control siRNA were used to transfect MSCs using a Lipofectamine RNAiMAX Reagent Kit (Invitrogen, 13778-075)

(9) Mst1 deletion attenuates renal ischaemia-reperfusion injury: The role of microtubule cytoskeleton dynamics, mitochondrial fission and the GSK3β-p53 signalling pathwayRedox biologyJanuary 1, 2019Li H, Feng J, Zhang Y, Feng J, Wang Q, Zhao S, Meng P, Li J.

(10) MFN2 ameliorates cell apoptosis in a cellular model of Parkinson's disease induced by rotenoneExperimental and therapeutic medicineOctober 1, 2018Yang Y, Xue LJ, Xue X, Ou Z, Jiang T, Zhang YD.

(11) The Causal Role of Mitochondrial Dynamics in Regulating Insulin Resistance in Diabetes: Link through Mitochondrial Reactive Oxygen SpeciesOxidative medicine and cellular longevityJanuary 1, 2018Lin HY, Weng SW, Chang YH, Su YJ, Chang CM, Tsai CJ, Shen FC, Chuang JH, Lin TK, Liou CW, et al.RG202218; RG202046; RG202560; Origene Technologies, Inc., Rockville, MD, USA) and siRNA (sc-43927; sc-43928; sc-43732; sc-60643; Santa Cruz Biotechnology, Santa Cruz, CA) spanned 24 and 48 h, respectively. Mock

(12) Upregulation of miR-195 accelerates oxidative stress-induced retinal endothelial cell injury by targeting mitofusin 2 in diabetic ratsMolecular and cellular endocrinologySeptember 5, 2017Zhang R, Garrett Q, Zhou H, Wu X, Mao Y, Cui X, Xie B, Liu Z, Cui D, Jiang L, et al.

(13) Deletion of PRKAA triggers mitochondrial fission by inhibiting the autophagy-dependent degradation of DNM1LAutophagyFebruary 1, 2017Wang Q, Wu S, Zhu H, Ding Y, Dai X, Ouyang C, Han YM, Xie Z, Zou MH.

(14) A neuronal network of mitochondrial dynamics regulates metastasisNature communicationsDecember 19, 2016Caino MC, Seo JH, Aguinaldo A, Wait E, Bryant KG, Kossenkov AV, Hayden JE, Vaira V, Morotti A, Ferrero S, et al.(Santa Cruz, sc-93809), Miro2 (Santa Cruz, sc-93029), Mfn1 (Santa Cruz sc-43927) or Mfn2 (Santa Cruz sc-43928). Tumour cells were transfected with the individual siRNA pools at 30–60 nM concentration in the presence

(15) Metabolic Stress-Induced Phosphorylation of KAP1 Ser473 Blocks Mitochondrial Fusion in Breast Cancer CellsCancer researchSeptember 1, 2016Cheng CT, Kuo CY, Ouyang C, Li CF, Chung Y, Chan DC, Kung HJ, Ann DK.L-lysine (0.8 mM). Etomoxir (sc-215009), siRNAs against p38α (sc-29433), p38β (sc-39116) and Mfn2 (sc-43928) were from Santa Cruz biotechnology. N-acetyl-L-cysteine (A7250), Mdivi-1 (M0199), D-glucose (G7021),

(16) Mitochondrial oxidative phosphorylation controls cancer cell's life and death decisions upon exposure to MAPK inhibitorsOncotargetJune 28, 2016Corazao-Rozas P, Guerreschi P, André F, Gabert PE, Lancel S, Dekiouk S, Fontaine D, Tardivel M, Savina A, Quesnel B, et al.transient transfection, melanoma cells (18 × 105 cells) were transfected with either 40pMol Mfn2-targeted siRNA (sc-43928, Santa Cruz or KH18422P, Qiagen) or with non-specific siRNA (sc-37007). Transfections were performed

(17) PI3K therapy reprograms mitochondrial trafficking to fuel tumor cell invasionProceedings of the National Academy of Sciences of the United States of AmericaJuly 14, 2015Caino MC, Ghosh JC, Chae YC, Vaira V, Rivadeneira DB, Faversani A, Rampini P, Kossenkov AV, Aird KM, Zhang R, et al.

(18) Mitochondrial dysfunction during in vitro hepatocyte steatosis is reversed by omega-3 fatty acid-induced up-regulation of mitofusin 2Metabolism: clinical and experimentalJune 1, 2011Zhang Y, Jiang L, Hu W, Zheng Q, Xiang W.

Be the First to Write a Review!

Mfn2 siRNA (h)

Mfn2 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (18)

Reviews

Mfn2 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map